• Mikaël Salson's avatar
    alternative_genes.should-get: Cannot determine the third alternative gene · 0a23db36
    Mikaël Salson authored
    IGHJ5*01 and IGHJ5*02 are equally good. Without #3414
    we can have either sequences.
    
    Alignment:
    read             gactactggggccagggaaccctggtcaccgtctcctcag
    IGHJ4*01   8     ..............A.........................
    IGHJ4*02   8     ........................................
    IGHJ4*02   8     ..............A..G......................
    IGHJ5*01  11     ....C.........A.........................
    IGHJ5*02  11     ...CC...................................
    0a23db36
Name
Last commit
Last update
algo Loading commit data...
browser Loading commit data...
demo Loading commit data...
doc Loading commit data...
docker Loading commit data...
germline Loading commit data...
packaging Loading commit data...
reports Loading commit data...
server Loading commit data...
tools Loading commit data...
.gitignore Loading commit data...
.gitlab-ci.yml Loading commit data...
.landscape.yml Loading commit data...
INSTALL.md Loading commit data...
Makefile Loading commit data...
Makefile.algo Loading commit data...
README.md Loading commit data...
mkdocs.yml Loading commit data...
requirements.txt Loading commit data...