Provide information when marked_pos (CDR3) is not found
It may happen that we don't find the CDR3 because there are too many deletions either in the V or the J genes that go beyond the marked_pos. In such a case the CDR3 will not be found and no reason will be provided for that. More generally if the marked_pos is not set in the germline, the user doesn't have that information. The user can only see that no CDR3 was found with no reason given for that (which is not the case for productivity).
We should give some information about it.
Here is an example where the marked_pos is deleted (appears in position 277/290 of the V gene but we have 16 deletions in the V).
GCTGTCATCTCTCAAAAGCCAAGCAGGGATATCTGTCAACGTGGAACCTCCCTGACGATCCAGTGTCAAGTCGATAGCCAAGTCACCATGATGTTCTGGTACCGTCAGCAACCTGGACAGAGCCTGACACTGATCGCAACTGCAAATCAGGGCTCTGAGGCCACATATGAGAGTGGATTTGTCATTGACAAGTTTCCCATCAGCCGCCCAAACCTAACATTCTCAACTCTGACTGTGAGCAACATGAGCCCTGAAGACAGCAGCATAAATCCCCTTGGGGGTCCCTATAATTCACCCCTCCACTTTGGGAACGGGACCAGGCTCACTGTGACAGGTATGGGGGCTCCACTCTTGACTCGGGGGTGCCTGGGTTTGACTG