• Mikaël Salson's avatar
    alternative_genes.should-get: Cannot determine the third alternative gene · 0a23db36
    Mikaël Salson authored
    IGHJ5*01 and IGHJ5*02 are equally good. Without #3414
    we can have either sequences.
    
    Alignment:
    read             gactactggggccagggaaccctggtcaccgtctcctcag
    IGHJ4*01   8     ..............A.........................
    IGHJ4*02   8     ........................................
    IGHJ4*02   8     ..............A..G......................
    IGHJ5*01  11     ....C.........A.........................
    IGHJ5*02  11     ...CC...................................
    0a23db36
Name
Last commit
Last update
..
cgi Loading commit data...
core Loading commit data...
html Loading commit data...
lib Loading commit data...
tests Loading commit data...
tools Loading commit data...
Makefile Loading commit data...
create-git-version-h.sh Loading commit data...
release Loading commit data...
release.h Loading commit data...
vidjil.cpp Loading commit data...
vidjil.h Loading commit data...