THANK YOU
for using IMGT/V-QUEST

THE
INTERNATIONAL
IMMUNOGENETICS
INFORMATION SYSTEMŽ

WELCOME !

http://www.imgt.org


Date	Sun Nov 08 18:24:53 CET 2015	
IMGT/V-QUEST program version	3.3.5	
IMGT/V-QUEST reference directory release	201544-3	
Species	Homo sapiens	
Receptor type or locus	TR	
IMGT directory reference set	F+ORF+ in-frame P	

Search for insertions and deletions	yes	



CSV file: 2_IMGT-gapped-nt-sequences

Sequence number	Sequence ID	Functionality	V-GENE and allele	J-GENE and allele	D-GENE and allele	V-D-J-REGION	V-J-REGION	V-REGION	FR1-IMGT	CDR1-IMGT	FR2-IMGT	CDR2-IMGT	FR3-IMGT	CDR3-IMGT	JUNCTION	J-REGION	FR4-IMGT	
1	TRGV3*01_-13/4/-9_TRGJ1*02	unproductive	Homsap TRGV3*01 F	Homsap TRGJ1*01 F, or Homsap TRGJ1*02 F or Homsap TRGJ2*01 F			...........................................................................................................................................ggaaggccccacagcgtcttctgtactatgacgtctcc......accgcaagggatgtgttggaatcaggactcagtccaggaaagtattatactcatacaccc...aggaggtggagctggatattgagactgcaaaatctaattgaaaatgattctggggtctattactgtgcggcggaaactctttggcagtggaacaacac	...........................................................................................................................................ggaaggccccacagcgtcttctgtactatgacgtctcc......accgcaagggatgtgttggaatcaggactcagtccaggaaagtattatactcatacaccc...aggaggtggagctggatattgagactgcaaaatctaattgaaaatgattctggggtctattactgtgc	..............................................................................	....................................	.........................ggaaggccccacagcgtcttctgtac	tatgacgtctcc......accgcaagggat	gtgttggaatcaggactcagtccaggaaagtattatactcatacaccc...aggaggtggagctggatattgagactgcaaaatctaattgaaaatgattctggggtctattactgt	gcggcggaaactc	tgtgcggcggaaactcttt	gaaactctttggcagtggaacaacac	tttggcagtggaacaacac	
2	TRGV3*01_-0/2/-0_TRGJ1*02	productive	Homsap TRGV3*01 F	Homsap TRGJ1*02 F			...........................................................................................................................................ggaaggccccacagcgtcttctgtactatgacgtctcc......accgcaagggatgtgttggaatcaggactcagtccaggaaagtattatactcatacaccc...aggaggtggagctggatattgagactgcaaaatctaattgaaaatgattctggggtctattactgtgccacctgggacaggtgttattataagaaactctttggcagtggaacaacac	...........................................................................................................................................ggaaggccccacagcgtcttctgtactatgacgtctcc......accgcaagggatgtgttggaatcaggactcagtccaggaaagtattatactcatacaccc...aggaggtggagctggatattgagactgcaaaatctaattgaaaatgattctggggtctattactgtgccacctgggacagg	..............................................................................	....................................	.........................ggaaggccccacagcgtcttctgtac	tatgacgtctcc......accgcaagggat	gtgttggaatcaggactcagtccaggaaagtattatactcatacaccc...aggaggtggagctggatattgagactgcaaaatctaattgaaaatgattctggggtctattactgt	gccacctgggacaggtgttattataagaaactc	tgtgccacctgggacaggtgttattataagaaactcttt	ttattataagaaactctttggcagtggaacaacac	tttggcagtggaacaacac	
3	TRGV3*01_-1/4/-0_TRGJ1*02	unproductive	Homsap TRGV3*01 F	Homsap TRGJ1*02 F			...........................................................................................................................................ggaaggccccacagcgtcttctgtactatgacgtctcc......accgcaagggatgtgttggaatcaggactcagtccaggaaagtattatactcatacaccc...aggaggtggagctggatattgagactgcaaaatctaattgaaaatgattctggggtctattactgtgccacctgggacagcgctttattataagaaactctttggcagtggaacaacac	...........................................................................................................................................ggaaggccccacagcgtcttctgtactatgacgtctcc......accgcaagggatgtgttggaatcaggactcagtccaggaaagtattatactcatacaccc...aggaggtggagctggatattgagactgcaaaatctaattgaaaatgattctggggtctattactgtgccacctgggacag	..............................................................................	....................................	.........................ggaaggccccacagcgtcttctgtac	tatgacgtctcc......accgcaagggat	gtgttggaatcaggactcagtccaggaaagtattatactcatacaccc...aggaggtggagctggatattgagactgcaaaatctaattgaaaatgattctggggtctattactgt	gccacctgggacagcgctttattataagaaactc	tgtgccacctgggacagcgctttattataagaaactcttt	ttattataagaaactctttggcagtggaacaacac	tttggcagtggaacaacac	
4	TRGV3*01_-0/9/-5_TRGJ1*02	unproductive	Homsap TRGV3*01 F	Homsap TRGJ1*02 F			...........................................................................................................................................ggaaggccccacagcgtcttctgtactatgacgtctcc......accgcaagggatgtgttggaatcaggactcagtccaggaaagtattatactcatacaccc...aggaggtggagctggatattgagactgcaaaatctaattgaaaatgattctggggtctattactgtgccacctgggacaggctcaagggaataagaaactctttggcagtggaacaacac	...........................................................................................................................................ggaaggccccacagcgtcttctgtactatgacgtctcc......accgcaagggatgtgttggaatcaggactcagtccaggaaagtattatactcatacaccc...aggaggtggagctggatattgagactgcaaaatctaattgaaaatgattctggggtctattactgtgccacctgggacagg	..............................................................................	....................................	.........................ggaaggccccacagcgtcttctgtac	tatgacgtctcc......accgcaagggat	gtgttggaatcaggactcagtccaggaaagtattatactcatacaccc...aggaggtggagctggatattgagactgcaaaatctaattgaaaatgattctggggtctattactgt	gccacctgggacaggctcaagggaataagaaactc	tgtgccacctgggacaggctcaagggaataagaaactcttt	ataagaaactctttggcagtggaacaacac	tttggcagtggaacaacac	
5	TRGV3*01_-2/5/-2_TRGJ1*01	unproductive	Homsap TRGV3*01 F	Homsap TRGJ1*01 F, or Homsap TRGJ2*01 F			...........................................................................................................................................ggaaggccccacagcgtcttctgtactatgacgtctcc......accgcaagggatgtgttggaatcaggactcagtccaggaaagtattatactcatacaccc...aggaggtggagctggatattgagactgcaaaatctaattgaaaatgattctggggtctattactgtgccacctgggacatggggattattataagaaactctttggcagtggaacaacac	...........................................................................................................................................ggaaggccccacagcgtcttctgtactatgacgtctcc......accgcaagggatgtgttggaatcaggactcagtccaggaaagtattatactcatacaccc...aggaggtggagctggatattgagactgcaaaatctaattgaaaatgattctggggtctattactgtgccacctgggaca	..............................................................................	....................................	.........................ggaaggccccacagcgtcttctgtac	tatgacgtctcc......accgcaagggat	gtgttggaatcaggactcagtccaggaaagtattatactcatacaccc...aggaggtggagctggatattgagactgcaaaatctaattgaaaatgattctggggtctattactgt	gccacctgggacatggggattattataagaaactc	tgtgccacctgggacatggggattattataagaaactcttt	attattataagaaactctttggcagtggaacaacac	tttggcagtggaacaacac	

-> IMGT/V-QUEST Documentation
-> IMGT/V-QUEST Search page