vidjil issueshttps://gitlab.inria.fr/vidjil/vidjil/-/issues2023-10-18T17:56:11+02:00https://gitlab.inria.fr/vidjil/vidjil/-/issues/5172consensus sequence length: mix of sequence with a nucleotide mix at a positio...2023-10-18T17:56:11+02:00THONIER Florianconsensus sequence length: mix of sequence with a nucleotide mix at a position in the V geneSee sample 59910-50, with either configurations [IGH](https://app.vidjil.org/59910-2?clone=26) or [no-clusterign](https://app.vidjil.org/59910-50?).
We can see that in multi, top clonotype have a short consensus length for read that are...See sample 59910-50, with either configurations [IGH](https://app.vidjil.org/59910-2?clone=26) or [no-clusterign](https://app.vidjil.org/59910-50?).
We can see that in multi, top clonotype have a short consensus length for read that are able to get entire V gene. We can see in no clustering that top 2 clonotypes have a mix of C/T at this specific position that cut the consensus sequence.
In these case, maybe we can extend consensus but show (but how?) the mix of nucleotides.
* bypass mix with a color scale to represent variation. Can also be used to show variation in case of merge of clonotype.
* hover can show precise values variationhttps://gitlab.inria.fr/vidjil/vidjil/-/issues/5170API; settable groups for creations of sets2024-01-15T16:40:49+01:00THONIER FlorianAPI; settable groups for creations of setsBy default, set are created with a link with group 1 and this value is not settable.
With this, creation success, but new set are not associated with a group because user have no right on group 1 (admin).
We need to add a way to give a...By default, set are created with a link with group 1 and this value is not settable.
With this, creation success, but new set are not associated with a group because user have no right on group 1 (admin).
We need to add a way to give a group number at the creation (easy) and to allow user to get list of his groups to use it for creation (need to modify controller).
Good news, some functions already exist in web2py and probably py4web to get this values, but are not linked to a controller to expose it.https://gitlab.inria.fr/vidjil/vidjil/-/issues/5169py4web: after user creation, redirection fails2023-12-05T14:51:37+01:00Mikaël Salsonpy4web: after user creation, redirection failsAfter user creation (which succeeds), redirection to the index page fails.After user creation (which succeeds), redirection to the index page fails.Server - py4webCHESNIN ClementCHESNIN Clementhttps://gitlab.inria.fr/vidjil/vidjil/-/issues/5168Build our docker images on Alpine rather than Ubuntu2024-03-27T14:32:22+01:00Mikaël SalsonBuild our docker images on Alpine rather than UbuntuImages should be lighter.
Discussed with @clement.chesnin @fthonierImages should be lighter.
Discussed with @clement.chesnin @fthonierhttps://gitlab.inria.fr/vidjil/vidjil/-/issues/5167Can create generic set with some rules to select samples to import2023-10-11T18:14:43+02:00THONIER FlorianCan create generic set with some rules to select samples to importI want for a meta-analysis create a set with some samples that have in my case a similar tags.
That make me think about a dynamic playlist for music, with a list of rules to compose it.
It could be usefull to be able de to create a set...I want for a meta-analysis create a set with some samples that have in my case a similar tags.
That make me think about a dynamic playlist for music, with a list of rules to compose it.
It could be usefull to be able de to create a set by giving some rules, for example tags, number of reads, age of patient, disease, ...).
In this case, sample of a set should probably be constant with a refresh button if needed to update list.
This would improve usage of server for research purpose I presume.
This usage could also be benifit for appstats.
A button to generate a fuse without needing of relaunch an analysis should also be present I think.https://gitlab.inria.fr/vidjil/vidjil/-/issues/5166CI; use registry for cypress2023-10-05T15:47:00+02:00THONIER FlorianCI; use registry for cypressUse local gitlab registry for docker image.
* [ ] Use image for cypress
* [ ] Use image for server
* [ ] Use for algo (gcc, clang, ...)Use local gitlab registry for docker image.
* [ ] Use image for cypress
* [ ] Use image for server
* [ ] Use for algo (gcc, clang, ...)https://gitlab.inria.fr/vidjil/vidjil/-/issues/5165CI; Adapt variable to new gitlab version (v16)2023-10-05T07:27:38+02:00THONIER FlorianCI; Adapt variable to new gitlab version (v16)Need to change at least `CI_BUILD_REF_SLUG` by `CI_COMMIT_REF_SLUG`Need to change at least `CI_BUILD_REF_SLUG` by `CI_COMMIT_REF_SLUG`https://gitlab.inria.fr/vidjil/vidjil/-/issues/5164Non-recombined sequence leading to IGK false positive.2023-09-07T16:31:35+02:00Mikaël SalsonNon-recombined sequence leading to IGK false positive.See ~"NAN - Nantes" email on 2023-08-10 mentioning this issue:
He points this sequence:
```
ATGTGGACTCCCTCATGAGCAGATGCCACCAGGGCCACTGGCCCCAGCTTCCTCCTTCACAGCTGCAGTGGGGGCTGGGGCTGGGGCATCCCAGGGAGGGTTTTTGTATGAGCCTGTGTCACAGTGTGTGGTATTCGGCGGAG...See ~"NAN - Nantes" email on 2023-08-10 mentioning this issue:
He points this sequence:
```
ATGTGGACTCCCTCATGAGCAGATGCCACCAGGGCCACTGGCCCCAGCTTCCTCCTTCACAGCTGCAGTGGGGGCTGGGGCTGGGGCATCCCAGGGAGGGTTTTTGTATGAGCCTGTGTCACAGTGTGTGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTGAGTCTCTTCTCCCCTCTCCTTCCCCGCTCTTGGGACAATTTCTGCTGTTTTTGTTTGTTTCTGTATCTTGTCTCA
```
where we find a `IGKV2D-29 0/78/7 J4`https://gitlab.inria.fr/vidjil/vidjil/-/issues/5162Contrôleur pour supprimer les données associées à un compte2024-01-18T14:50:43+01:00Mikaël SalsonContrôleur pour supprimer les données associées à un compteIl faudrait pouvoir supprimer toutes les données associées à un compte.
À faire avec prudence néanmoins quand l'utilisateur appartient à un groupe commun.
On se pose la question du RGPD : les données uploadées et analysées sont-elles de...Il faudrait pouvoir supprimer toutes les données associées à un compte.
À faire avec prudence néanmoins quand l'utilisateur appartient à un groupe commun.
On se pose la question du RGPD : les données uploadées et analysées sont-elles des données personnelles et soumises au RGPD (ie. si un utilisateur nous demande à tout supprimer de ce qu'il a uploadé est-on obligé de le faire, a fortiori quand il est dans un groupe) ?https://gitlab.inria.fr/vidjil/vidjil/-/issues/5161Analysis with long reads (thousands of pb)2023-08-30T10:24:56+02:00THONIER FlorianAnalysis with long reads (thousands of pb)We have a user that load data with long reads (thousands of pb).
Results are here and are not very usefull : https://app.vidjil.org/59029-25?
We saw 20% of VDJ. Majority of "Possibly XXX".We have a user that load data with long reads (thousands of pb).
Results are here and are not very usefull : https://app.vidjil.org/59029-25?
We saw 20% of VDJ. Majority of "Possibly XXX".https://gitlab.inria.fr/vidjil/vidjil/-/issues/5160Py4Web: changement de comportement de VidjilAuth2023-08-31T16:09:25+02:00Mikaël SalsonPy4Web: changement de comportement de VidjilAuthOn a vu avec @fthonier que VidjilAuth est désormais défini une fois pour toute dans Py4Web, alors qu'auparavant il était redéfini à chaque requête.
On stockait dans VidjilAuth des permissions pour ne pas avoir à les recharger plein de f...On a vu avec @fthonier que VidjilAuth est désormais défini une fois pour toute dans Py4Web, alors qu'auparavant il était redéfini à chaque requête.
On stockait dans VidjilAuth des permissions pour ne pas avoir à les recharger plein de fois lors d'un même appel à un contrôleur. Ce n'est plus possible puisque VidjilAuth sert désormais à la fois pour tous les utilisateurs.
Il faudra donc virer `self.permissions` dans `VidjilAuth` et voir l'impact en ressources.https://gitlab.inria.fr/vidjil/vidjil/-/issues/5159Ł caracter create a failure on server2023-08-16T11:35:39+02:00THONIER FlorianŁ caracter create a failure on serverThis character (Ł)[https://fr.wikipedia.org/wiki/%C5%81] create a fail at the preprocess step.
It is include by (unicode)[https://www.unicodepedia.com/unicode/latin-extended-a/142/latin-small-letter-l-with-stroke/].
In that case, no resu...This character (Ł)[https://fr.wikipedia.org/wiki/%C5%81] create a fail at the preprocess step.
It is include by (unicode)[https://www.unicodepedia.com/unicode/latin-extended-a/142/latin-small-letter-l-with-stroke/].
In that case, no result are returned, no file created, no log neither.
If I manually launch preprocess, it seem to complete normally. But the file name replace this character by octal utf encoding ('\305\202')
```bash
python flash2.py /usr/share/pear/ /mnt/upload/uploads/sequence_file.data_file.xxx.gz /mnt/upload/uploads/sequence_file.data_file.YYY.gz /mnt/result/tmp/pre/out-119703//AAA_łxxx.fastq.gz -r2 -f "-M 300"
--> created file: AAA_'$'\305\202''xxx.fastq.gz
```
I presume that error are with the server.
This issue concern web2py version of server. Don't know for futur py4web version.https://gitlab.inria.fr/vidjil/vidjil/-/issues/5158Non-recombined sequences beyond D7-27/J12023-10-06T11:09:00+02:00Mathieu GiraudNon-recombined sequences beyond D7-27/J1
As the sequencing lengths increase, some user reported us the following sequences that may be non-recombined as "IGHD7-27 - IGHJ1" (see #2232/!242)
- IGLV4-60 - IGLJ5
- TRBV6-9 - TRBJ2-2P
- TRBV6-1 - TRBJ2-2P
Todo !1345:
- [x] extend ...
As the sequencing lengths increase, some user reported us the following sequences that may be non-recombined as "IGHD7-27 - IGHJ1" (see #2232/!242)
- IGLV4-60 - IGLJ5
- TRBV6-9 - TRBJ2-2P
- TRBV6-1 - TRBJ2-2P
Todo !1345:
- [x] extend segment.cpp to handle other cases
- [ ] check these three cases, make tests such as `data/D7-27--J1.fa`
- [ ] fill the cases in segment.hhttps://gitlab.inria.fr/vidjil/vidjil/-/issues/5157API and Py4web: make it work2023-11-28T13:07:50+01:00THONIER FlorianAPI and Py4web: make it workFor the moment, API don't work out of the box:
* some forms have variation on dom ids
* Auth user is not directly accessible
* Use of generic.json as in web2py seem to be impossible (or at least modified and not documented).For the moment, API don't work out of the box:
* some forms have variation on dom ids
* Auth user is not directly accessible
* Use of generic.json as in web2py seem to be impossible (or at least modified and not documented).Server - py4webhttps://gitlab.inria.fr/vidjil/vidjil/-/issues/5156Get some metrics from a server2024-01-22T14:22:32+01:00THONIER FlorianGet some metrics from a serverTHinking about it with @mikael-s : A way to get some metrics is to use prometheus and grafana. And as by default Prometheus use web resquest to get metrics, a way to get it with security is to use vidjil API to ask, as admin. APi seem to...THinking about it with @mikael-s : A way to get some metrics is to use prometheus and grafana. And as by default Prometheus use web resquest to get metrics, a way to get it with security is to use vidjil API to ask, as admin. APi seem to be a good way for that.
I try to create a really small dockerized flask application that will execute API to ask metrics and serve them locally.
My quick overview failed since the API is incompatible with py4web (other issue/MR).
Is it a good way to do it ?Web 2024.04https://gitlab.inria.fr/vidjil/vidjil/-/issues/5155Follow-up from "Draft: Py4web; apply mulitple changes to backend server code."2023-11-06T15:04:09+01:00THONIER FlorianFollow-up from "Draft: Py4web; apply mulitple changes to backend server code."The following discussion from !1338 should be addressed:
- [ ] @fthonier started a [discussion](https://gitlab.inria.fr/vidjil/vidjil/-/merge_requests/1338#note_862390):
> Supprimer aussi les règles associées.The following discussion from !1338 should be addressed:
- [ ] @fthonier started a [discussion](https://gitlab.inria.fr/vidjil/vidjil/-/merge_requests/1338#note_862390):
> Supprimer aussi les règles associées.Web 2023.10https://gitlab.inria.fr/vidjil/vidjil/-/issues/5153Envoyer les données vers vdj.online2023-07-13T09:22:10+02:00Mikaël SalsonEnvoyer les données vers vdj.onlinehttps://vdj.online/
Service de MiXCR.
À discuter, peut-être pas très pratique à intégrer, car il faut renseigner pas mal d'info sur le protocole expérimental.https://vdj.online/
Service de MiXCR.
À discuter, peut-être pas très pratique à intégrer, car il faut renseigner pas mal d'info sur le protocole expérimental.https://gitlab.inria.fr/vidjil/vidjil/-/issues/5151Exports tableur des patients/runs/sets2023-06-30T11:03:14+02:00Mathieu GiraudExports tableur des patients/runs/sets
Demande de @Aurelie : récupérer la liste des patients (nom/prénom/date), en particulier pour de temps en temps regarder les doublons. Plus généralement, pouvoir récupérer toute requête patient/run/set
@fthonier : "Pas de soucis de perf...
Demande de @Aurelie : récupérer la liste des patients (nom/prénom/date), en particulier pour de temps en temps regarder les doublons. Plus généralement, pouvoir récupérer toute requête patient/run/set
@fthonier : "Pas de soucis de performance s'il n'y pas de requêtes croisées"https://gitlab.inria.fr/vidjil/vidjil/-/issues/5150Follow-up from "Feature sc/remove watir testing complete"2023-11-06T14:31:53+01:00THONIER FlorianFollow-up from "Feature sc/remove watir testing complete"The following discussion from !1324 should be addressed:
- [ ] @fthonier started a [discussion](https://gitlab.inria.fr/vidjil/vidjil/-/merge_requests/1324#note_847594):
> Make a new MR to import these testsThe following discussion from !1324 should be addressed:
- [ ] @fthonier started a [discussion](https://gitlab.inria.fr/vidjil/vidjil/-/merge_requests/1324#note_847594):
> Make a new MR to import these testshttps://gitlab.inria.fr/vidjil/vidjil/-/issues/5149Replace vidjil (beta) by vidjil (version)2024-01-19T19:06:19+01:00THONIER FlorianReplace vidjil (beta) by vidjil (version)I think it time to change it.
We could also have a button in help menu with "À propos" properties; as a complete list of version of server, client, algo, external softwares ...
For the moment, we only show version of client in the con...I think it time to change it.
We could also have a button in help menu with "À propos" properties; as a complete list of version of server, client, algo, external softwares ...
For the moment, we only show version of client in the console, and server in the admin page.Web 2024.04