...
  View open merge request
Commits (6)
# each of these sequences are compatible with allele 01 & 02.
# So a warning will be called
>IGLV1-1*01 0//2 IGLJ*01
CTGGGGTCCAAGCCGACGACGAGGCTGTCTATTACTGTGGGAGTGCAGACAGCAGCAGTACTGCTGGTATATTTGGGGCCGGGACAACCCTGACCGTCCTAGGCCAGCCCAAGGTGGCCCCCACCATCACCCTCTTCCCA
>IGLV1-1*01 0/C/6 IGLJ*01
GGTCCAAGCCGACGACGAGGCTGTCTATTACTGTGGGAGTGCAGACAGCAGCAGTACTGCTGCATTTGGGGCCGGGACAACCCTGACCGTCCTAGGCCAGCCCAAGGTGGCCCCCACCATCACCCTCTTCCCACCGTCAAAG
>IGLV1-4*01 0//6 IGLJ*01
GCCGACGACGAGGCTGTCTATTACTGTGGGAGTGCAGACAGCAGCTATGTTGGTATATTTGGGGCCGGGACAACCCTGACCGTCCTAGGCCAGCCCAAGGTGGCCCCCACCATCACCCTCTTCCCACCGTCAAAGGA
\ No newline at end of file
!LAUNCH: $VIDJIL_DIR/$EXEC -3 -c designations -g $VIDJIL_DIR/germline/gallus-gallus.g $VIDJIL_DATA/specie_gallus-gallus.fa
# each sequence here can be allele *01 or *02.
$ First clone is correctly found
1:IGLV1-1.01 0//2 IGLJ.01
$ Second clone is correctly found
1:IGLV1-1.01 0/C/6 IGLJ.01
$ Third clone is correctly found
1:IGLV1-4.01 0//6 IGLJ.01
......@@ -29,7 +29,7 @@
"follows": "IGH",
"recombinations": [ {
"5": ["IGHD+up.fa"],
"3": ["IGHJ+down.fa"]
"3": ["IGHJ.fa"]
} ],
"parameters": {
"seed": "12s"
......
59
2019-05-23
\ No newline at end of file