...
  View open merge request
Commits (4)
......@@ -1402,10 +1402,6 @@ void FineSegmenter::toOutput(CloneOutput *clone){
});
}
}
else // not segmented
{
clone->set("name", label);
}
}
json toJsonSegVal(string s) {
......
>unexpected_name
TGTTTGCAGGTGTCCAGTGTCAGGTGAAACTGGTGGAGTCTGGGGGAGGCGTGGTCCGCCCTGGGAGGTCCCTGAGACTCTCCTGTGCCGACCTCCAGGACAGAGGACGCTGGGCCCAGAGAGACGAGGCAGAAAGAACCCCTCGTTCTTGAAGAGACGGTGACCATCGTCCCTTGGCCGCAGATATCGAAAGCATCATTTCCCCTGTCACAGTAGTCGATTCTACTAAAAGAGTCGCGGCCCCTAGTTTGACTACTGGGGCCAGAGAACCCTGGTCACCGTCTCCTCAGGTAAG
\ No newline at end of file
......@@ -5,3 +5,10 @@ $ The KmerSegmenter segments the chimera on xxx germline (-2)
$ The FineSegmenter gives the locus information (-2)
1:Unexpected .*\+IGKV/-IGKV
!NO_LAUNCHER:
!LAUNCH: cat out/2549.vidjil
$ The designation is the "name" field in the .json
1: "name": "IGKV1/OR-2.01 21//15 IGKV1/OR-2.01"
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -g $VIDJIL_DIR/germline/homo-sapiens.g -r 1 $VIDJIL_DATA/unexpected_name.fa ; cat out/unexpected_name.vidjil
$ Name of unsegmented sequence should be the window itself
1: "id": "TCGTTCTTGAAGAGACGGTGACCATCGTCCCTTGGCCGCAGATATCGAAA"