Commit ff16f107 authored by Mathieu Giraud's avatar Mathieu Giraud

tests: add tests

Close #3572 and #3573.
parent 81af152d
......@@ -5,13 +5,16 @@ $ There are four lines, all with tabs
4:\t
$ The required AIRR fields are present
:consensus_count
:v_call d_call j_call
:sequence_id
:sequence
:sequence_alignment
:germline_alignment
:v_cigar d_cigar j_cigar
:v_cigar d_cigar j_cigar
:junction
:junction_aa
:productive
:rev_comp
$ Three clones on IGH
3:IGH
......@@ -20,12 +23,20 @@ $ One clone has 8 reads, two clones have 5 reads
1:IGH 8
2:IGH 5
$ Two clones are productive, no clone is labeled as non-productive
2:\tT\t
0:\tF\t
$ v_call for 2 clones (-z 2)
2:IGHV
$ First clone window appears third times (clone_id, sequence_id, sequence)
w3:TATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTG
$ Junction of the first clone appears once, but CDR3 twice (it is also included in the junction)
1:CTREEQYSSWYFDFW
w2:TREEQYSSWYFDF
$ No spurious character
0:"
0:@
......
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment