Commit fd75f312 authored by Mathieu Giraud's avatar Mathieu Giraud

tests: remove locus from do_not_segment.should-locus.fa

This test is to ensure that the sequences are UNSEG. The locus should not be tested here.
parent 82a50d11
>__TRG_UNSEG
>___UNSEG
GGTAGTAGCAAATATTCAAACGAGAACTTTGAAGGCCGAAGTGGAGAAGGCTTCCATGTGAACAGCAGTTGAACATGGGTCAGTCGGTCCTGAGAGA
>seq-317-1__TRG_UNSEG
>seq-317-1__UNSEG
ATGAAGTTTTTTTGATGGCTTGAGATGGCTCACAAATTTTGATTTTTTTTTCTTCCTTGTGCTCCCTTTTTTTCTCCTTGCTTTTCCAGTTAACATCTATATTCACATGTAATCTTGTTTTCTCTTCACATTCACTGAGTTGTTCAGGCT
>seq-317-2__TRD_UNSEG
>seq-317-2__UNSEG
GAAGGAAGAGATTTGAAATAAAGCTTTGGTTTCTGAGGAATGTTGCCGTTTGAGAGATTCAAAAAGAAAGAAGATCCAAATTTCGGGACTGGTGTTTAAATTGTAGTGACAGATTTTGGGGGCCATTAAAGGTATGGGAGTGAAA
>seq-317-3__TRD+_UNSEG
>seq-317-3__UNSEG
ACTAACAGTAACTGCCATTTTTTGTCTGTGATAACAGAGTGATTTGTAAAACAGTGGTTGTTTTTTCATTGTGTTTTCTTCGTGGATTGTTTTTTCTGCGGGTCATATTCATACCTTCTGATGAAGTTGTACAACACCAGCAACATT
>seq-317-4__IGK+_UNSEG
>seq-317-4__UNSEG
AGGTATGGTTGCGCTCAGTATAACAAGTGCTGAACAGAAAGCCAGGAAGGGAGGCGAACACAGCCACTGACCATGTAGCCAAACTGGTGATGACCCCATAAGTCAAGGTCCTTGCCCTCAAGGAAAACACCGCGTGCACAAT
>seq-317-5__IGL_UNSEG
>seq-317-5__UNSEG
GTGCAAGGATCAGAAGATAACGAAACGTCCACTTCCTGAAGGGTGGGAAAAAAAGAAAAAGAAAAAGGAGCCACCCACGCTGGAGATGTCCGTTTTAGATCTTCTTATTTTCTTCCCTTTCGCTTCGGTTTTTCTTCTCGAGGCTCA
>seq-317-6__TRD_UNSEG
>seq-317-6__UNSEG
GGTGTGACCGGGGCTTTGGTGGACCCTATTGTGTTCCTGTTGTTCCTCTGCCCTCGATTCTTAAAGACGATTTCAATGGGAATTTACATCCTGACCTTTGGCCTGAAGTGTATGGTGCAGAGA
>seq-317-7__TRD+_UNSEG
>seq-317-7__UNSEG
GTGGTGGTTCTGGTCCTGTTCAAATACAAGCGGCTCAGGTCCATGACTGATGTGTACCTGCTCAACCTTGCCATCTCGGATCTGCTCTTCGTGTTTTCCCTCCCTTTTTGGGGCTACTATGCAGCAGACCAGTGGGTTTTTGGGCTAGGTC
>seq-317-8__TRD+_UNSEG
>seq-317-8__UNSEG
GTTGCTTAAGATCAGTTGCTTTTATACTCAGAATGGAAATACCTGATCTTGGCTAGCTTTGTTTGTTA
>seq-317-9__IGK+_UNSEG
>seq-317-9__UNSEG
GGGCAGCAGCCCAGTCTTCCTACTGTCTGATTTAATTACAGCGGTTCCTGTGGGAGTGGGGGCTGTTATTCTCTTAAACATTTGCAGCTTGAAACAGTTGAGGAAGCAGCTTTAAAAAAAAAAAATCTCCCTACCCCCAACAA
>seq-317-10__IGH_UNSEG
>seq-317-10__UNSEG
GGGCAGAGAGTGCTGGGCTGAGTCGTATTGCTTTGCTAGACTTCCATAGGAATGGGCTTCTTGCGGCGAGAAAAGGGTGCCCCACCCTCTACTTGGACTACACTACTCTGAAACCTTGTGGCAGAGGCAGAGAAAAATCTGCTTTA
>seq-317-11__TRD+_UNSEG
>seq-317-11__UNSEG
AGCATACTCATCAGGCCAGTATTTGACACATTTACTCTTTCCTCTCTCCGCTTCTTTCATTGTCATGACAATCAGTCTGGAGTTTTGGAAAACCATCCGCCAAAAGTCGTTCACTGTGTTTTGTAGGCAGCCTTGTGTGGCAATGTAAC
>seq-317-12__TRD_UNSEG
>seq-317-12__UNSEG
AGGGAAACCTCAAGTGCTCGCAGAAGCATCGGCAAGTCAGGCGTCCTGTTTCTCGGATGGATACCCATTACCATCTTGGACCTGGAAGAAGTGTTCAGACAAGTCT
>seq-317-13__TRG_UNSEG
>seq-317-13__UNSEG
TGGATTCTGGTTTACAGCAGCTTTACAGTGATAGTTAAATTAACTGGGGCTAGGGGAAGAGCAAGCAAAAAGGGAAGAAGGACTCCTAGGCCCTTTCTAGTAAATCCTTCAGCAACAAGGCTGGCTTGGTGCCCTCCAAGCATCTAATG
>seq-317-14__TRG_UNSEG
>seq-317-14__UNSEG
ACCCTTTACCCTGATGATCTGTATTATATTTTAATGTATATGTGAATATATTGAAAATAATTTGTTTTTTCCTGGTTTTTGTTTGGTTTTCGTTTTGCTTTTAGCCTCTACATGCTAGGATCACAGGAAGACTTTGTAAGGACA
>seq-317-15__IGK_UNSEG
>seq-317-15__UNSEG
CATTTAATCTGATGTGGCATTTTCGTCATCTGAAGCATGAGTGACAAGTTGGGAATGATGTGGTGATTTAGAATGCAGTATTGGCCAAGTCCAAGTTGTCAACTTAAGCGTCTGTTTACCAAAGACCGGGAACAGGGGCCCAAACA
>seq-317-16__TRD+_UNSEG
>seq-317-16__UNSEG
TTTAGTTGTAGATTTCAATGGGATACGATAGGACAGAAAAGATTTTTTAAAAAGCAGAAAGAGTGTTTCATGGTGAAAGTACTGGGGGAGGGTGGACAAAGCATGCACACATGCCAATTTGAAAATCAAGTGTGACTTACCTCACGT
>seq-317-17__IGK+_UNSEG
>seq-317-17__UNSEG
CGGGATAGAGGGCAGTGGCACTATGAAAGTCAGCCATCTGGTGAGGCAGCAGCTGTCCGATGGCGTGGAACACAAGGCCCCCCACACGGAACATGTGCAGCCGTTCTCCCCGCTGAATGATGCTAGCGATTTGCTTCACCTCGTCC
>seq-317-18__IGK+_UNSEG
>seq-317-18__UNSEG
TGTCACCATTCACCTTGGACAGTGGGGCAGATTGGTTCCAATTGGGTTTCTCATCCTTGTCCACCGAAGATCCCTTTGTCACTGCAGCTTCTCTAGTGTCAGCCTCACTGCTGTCCTCCGTGAGGTGACCTTCAAAG
>seq-317-19__IGK+_UNSEG
>seq-317-19__UNSEG
CACCACTTTTAGTACCAACACTCTTGGGTGATTTCATGGACCCTAAAGCAGACCTGACACTGATCCAGATTTGCAGTCCATTTTTAAGGACACCTGTCTTTATTTCCTCAAAGTCAAGCAGCTTTCTCTGGAAAATGAATGCTAATTAGT
>seq-317-20__IGK+_UNSEG
>seq-317-20__UNSEG
AGACAGGATCAGGGACAGTCACATTAAAACACCATAGCACCATTTTATTTAGACTATTTCAATTCATAAAAATGCTTCCTAGTCCATAAAACACACTTCAGTAACAAAAGGAAAGAGATACTGGTTGAGGCACGTCAGGGATATCA
>seq-317-21__IGK+_UNSEG
>seq-317-21__UNSEG
GACCAGGGAGCTTGGTGAGCAGCCGGGGACTCTGGGAAGGGCTGAGAGCCAGCACAGCTGAGTGCTGTTGCTGTTGTTGCTGCTGCTGCTGCTGTTGTTGCTGCTGCTTGTTCCGATATTCTGCCATGAGATTAGTGTGCTCCTTC
>seq-317-22__IGK+_UNSEG
>seq-317-22__UNSEG
GTTTTATATCGTTGTAAAATAATTTTTCTAATTTTTTATAGGCTATGGATGAAATGAATGGCAAAGAAATAGAAGGGGAAGAAATTGAAATAGTCTTAGCCAAGCCACCAGACAAGAAAAGGAAAGAGCGCCAAGCTGCTAGACAGGCCTC
>seq-317-23__TRD_UNSEG
>seq-317-23__UNSEG
TTTTCAATGATCTAGATCAATACTTTGTTTCTCACCCATTTCATAATCAGTTTCTGCTACTCTCCTCATTTTGGGGGGTGTTGTGATCCCTGATTCCATTTCTTGCCTTTTAGGAGCCTTTGTGTCTGATATCAAGTGATCAAAA
>seq-317-24__TRG_UNSEG
>seq-317-24__UNSEG
ACTCCAGTCTGGGTGAAAGAGTGAGACCTTGTCTCAAAAAAGGAAGTGAAAGGTAATTAAAAAAGAACTTACGAAGGAAGGTCTTTGGCAGCTCTCAAGCCCCAGCCTTTCTTTTCTGTGAGTATGACTTCCACATCTGCATGCTGTTT
>seq-317-25__IGK_UNSEG
>seq-317-25__UNSEG
CTCTTTATTTGTCCCCTTGCCTCCCTTTCCAATGGACTATTTTAGAAGAAATGGAGCTGTCACCCACATCAAGATTCAGAACACTGGTGATTACTATGACCTGTATGGAGGGGAGAAATTTGCCACTTTGGCTGAGTTGGTCCAG
>seq-317-26__IGK+_UNSEG
>seq-317-26__UNSEG
GATGTGAAAGAAAGGGCGAAGGGTTTTTTGAGTTTTTGTTTTTGAGGAAGGGGAGTTGGGTACTTCTGCCTCTCCTAGCATGATAGGCATTCTCATAGCCAGGGACAGATTTTCTCCTGCAGCCCAGGGTGCTAAGCAGACATCTCTGGGA
>seq-317-27__IGK_UNSEG
>seq-317-27__UNSEG
CTCCATGGCACGAAAGGTCCTGGCTGTGATGGAGTCTCCTTCCTGAAATCCAATTTGTACCGGTCTCAACAGCAGGTCACTTCACCTGGACCCAGCTGAATCACCAGCTCCTTTTATGATATTTGTGTTTGTTTCACAATTTCTCAAGG
>seq-317-28__TRD+_UNSEG
>seq-317-28__UNSEG
AAGAGAACACACTTACTCTCCACGTCGCGGACACAGACGCCATAGAGGTACACGATGTGTTTGTGGGAGACCTGTCTCATCATGCTGGCTGCCTCGAAGAAGGCCTGTGGGCGAGCAGGACATAGGAATGTC
>seq-317-29__IGK+_UNSEG
>seq-317-29__UNSEG
GTCGGCGGCGTCGGCAGCAGTGTCGACGGCAGCGGCGGCGGCGGGTGGGAAATGGCGGAGTATCTGGCCTCCATCTTCGGCACCGAGAAAGACAAGTGAGTGGGAGCCCCCCGCCGGGGGTTGGGCGCGATCGGGGCGCAGGGTGGTTG
>seq-317-30__TRG_UNSEG
>seq-317-30__UNSEG
TGGTTGCTTGATAGGTAGGTACTCACCTATTCTCACAGATCTCCTTTTGTCGGCCTTGGTTGGGACAACATAAGAAACTCCAGGTTTCATGTCCATGTACTCATTAGTACTATCGCTGCTGGGAGAGATGAAACAAGTCATGAC
>seq-317-31__TRD+_UNSEG
>seq-317-31__UNSEG
TTGTCATAAATGCTTTTTGCTGTCACTCTAGTGGTTACTATCCTCTGCCTTCCTCTCCTCCCCTACTCCCCCAGAGAACCAAGGCGTCTGGGGGATTGACTGGGGGGCAGAGGGGGTTTCCCCAGCAAAATCAAACACCTGTCTCCAGAG
>seq-317-32__IGK+_UNSEG
>seq-317-32__UNSEG
ACAGCTACTATATTAGGAGGGATTCCATTTTCACAATTGCAAAACAGATATTTCAGGAACATGGGCCACAAAATGTACTCCTTTCACAGTGTTCTCCTCTTCTGAACTGTGCAGTTATCTATTAAATTTTC
>seq-317-33__TRD_UNSEG
>seq-317-33__UNSEG
GCACTCTGGGCCCGGACCGCCAACCAGCAGACCTGAACGTCCACATCAGACAGGATGGTTTTTCAATGGGAAGAAAACAAAGATGGCGACAGGAAGGAAACTGAGCAGGGAGGTATTTGTACTTTGGAGGTACAAGGGATCTACCCCA
>seq-317-34__IGK+_UNSEG
>seq-317-34__UNSEG
CTCGCGTTATGTGCGACGAGAACTCGTACCGGTCCTGGCTGTGGTAGCCGCACATGTTGCACTCAAAAGGATCACGGAAGCCGTGGCAGCCCATGTGGATGGTGTACATGACGTGATCCAGGAAGAGCACCCGGCAGTGTTCGCAC
>seq-317-35__TRB_UNSEG
>seq-317-35__UNSEG
CCCTGGGTCCTCCCCACATCCATGGTACTAGGAAGGAGAGTATCAAACCTGTTTGTAGGCTCTGAACCTTATGCTCAGCTTCCTCCAGCTTTGAGGTGGTGGACATCTGTGTCTCCTGCAGCTTTCTGCAAAGGAAGAG
>seq-317-36__IGK+_UNSEG
>seq-317-36__UNSEG
TGACCTTAAGAACTTTGTCTGGTGGCTTTGCTGGAACATTGTCACTGTTTTCACTGTCATGCAGGGAGCCCAGCACTGTGGCCAGGATGGCAGAGACTTCCTTGTCATCATGGAGAAGTGCCAGCAGGGGACTGGGAAAAGCACTCTAC
>seq-317-37__TRG_UNSEG
>seq-317-37__UNSEG
GCTGCTTCTCAGCAATGGCCTGAGAATTCACTTCTGTGCTACTAGTAGATGGAGGATTTGATACCTGTCCTTCAATGCTTACAGCTGGCTGGGAAAGCTGGGCAGAAAAAAAAGGGAAGTAGGTGAGACACACGCAGAGTCTGCCAAC
>seq-317-38__IGK+_UNSEG
>seq-317-38__UNSEG
GTGATAATCTTCATATGCAGTGCTTCTGGAGGCCTGTCTAGCAGCTTGGCGCTCTTTCCTTTTCTTGTCTGGTGCCTTGGCTAAGACTATTTCAAGTTCTTCCCCTTCTGTTTCTTTGCCATTCATTTCATCCATAGCCATAACAG
>seq-317-39__IGK+_UNSEG
>seq-317-39__UNSEG
TGCAGCTTTTGTTTTCTGTATGTTGTTGGGGGATCAACTTTCACACATAGCAAGCACATGGCCTCCCTGATGTCAGGATGCCTTTGTTAGGATCTGTATTTGCCCTTAATTTTGTTGAAATCTTTTTTCCTTCTTCCTCTTGAAAA
>seq-317-40__TRD_UNSEG
>seq-317-40__UNSEG
GAGGGCTGAGCTTCCCCTCAAACCTATCGAACATCTCATTGTGATTGGGGACATTTGACACACAGGTTCCTTGTGCAGCTTCAGAAAAAGAAATAGAGAGGAGAGATGCTTTGTTGGAATCATTCAAAACGAGGTCTATTCAACAC
>seq-317-41__IGK+_UNSEG
>seq-317-41__UNSEG
CACTATAAGACCGACTTCGACAAGAATAAGATCTGGTATGAGCACCGGCTCATTGATGACATGGTGGCTCAGGTCCTCAAGTCTTCGGGTGGCTTTGTGTGGGCCTGCAAGAACTATGACGGAGATGTGCAGTCAGACATC
>seq-317-42__IGL_UNSEG
>seq-317-42__UNSEG
GGACAGACCAGCCTCCATCCACAGCTCCCTTTAGGGCACCAAAAACTTTATTGCCAGCGGCAGTTCTGGCAAGCTCTGCATCCAAAGAGTAGACAAAGGCACCCAGCTGACCATCTATGCTCTCCACACTGTATTCATCGCCAGTC
>seq-317-43__TRD_UNSEG
>seq-317-43__UNSEG
ATCCAGGACTGCTCTGTTGGGCCTGGCTGGCCATGACTTGACCTGGGCCACCAACTCCCATATTGAGGTTAGGGGAACTACCAGATCGCAGCAATTCTGACAGCTGTTTATGTTTAGAAGCTGCATCTTGTACC
>seq-317-44__TRA_UNSEG
>seq-317-44__UNSEG
GTACTAGACAGTTTCATCAAAACCAGTGCAACAGGTGGCTTGGGATCAATAAAAGCTGAGGTGATGGCAGATACTGCTGTAGCTTTGGCTTCTGGAAATGTGAAATTGGTTTCAAGCAAGGTAATCACTTTTCTTTTGCCTTCTGTACTAT
>seq-317-45__TRD_UNSEG
>seq-317-45__UNSEG
AGCGAGAGTCCCTGCAGTCCCTTTCGACTTGCATTTTTGCAGGAGCAGTATCATGAAGCCTAAACGCGATGGATATATGTTTTTGAAGGCAGAAAGCAAAATTATGTTTGCCACTTTGCAAAGGAGCTCACTGTGGTGTCTGTGTTCC
>seq-317-46__IGK+_UNSEG
>seq-317-46__UNSEG
ACTTGAAGGCATCACTTTTAAGAAAGCTTACAGTTGGGCCCTGTACCATCCCAAGTCCTTTGTAGCTCCTCTTGAACATGTTTGCCATACTTTTAAAAGGGTAGTTGAATAAATAGCATCACCATTCTTTGCTGTGGCACAGG
>seq-317-47__IGH_UNSEG
>seq-317-47__UNSEG
ATCCAAGAGTAGCGCTCATGTTTTTTGACTCAAGAAAATAGGAAGTTTACTAACTGGCTTCCAGGAAAGGCCAAGGAGAGAAAGCCAATGGGAAGGAGGGTGGGGCAGAGGGACCCACACCAGGAAACCGCTGGCAGGTGGGGGATGGGCC
>seq-317-48__TRG_UNSEG
>seq-317-48__UNSEG
GCATTACCTTGCCTATTTTTAATATTATTAAAGCCTTTCTCCTTCAGTAGTCTATTTTCTTAGAATAACAACTCTTTTATCTATTCTGAACTCTATTTTTTTTCTTTTTTAAGAGACAAGGTTTTGCTCTGTTGCCCAGCTTGGACTCGAA
>seq-317-49__TRD_UNSEG
>seq-317-49__UNSEG
AAAAAAGCACAAAAATGGTCGGTGGGGAACCATATAACAAAACTACATCTCAGGCAGCTCTTTCTCAAGGAAGATTCTAAGATTTTATTATGTGGCTAATTCTAAATTGGAAATGGAACATGCTGGTATGTGAAGCAATTGGTGCTAGGA
>seq-317-50__IGL_UNSEG
>seq-317-50__UNSEG
CCTCCAGCTGGTGTTGGGAGCTTCTTCTTCTTCTCCTTGGGTGGTCTGTCTGGAAGCCGTGGGACAGGTGAACTTGGTGGGGGCCACCAGCCAGGAGCAGAAGGCTCTGAAGGAGCAGGGAAGGAGGTGTCGTGCACCTGTTCTAGGA
>seq-317-51__IGK+_UNSEG
>seq-317-51__UNSEG
GGGCTGGAGTTTCCTGTCAGCCTGTAACTGACCTTGGCACCTGCTTTCCTCCTCCAGAAGAGAAGAATCCCTACAAAGAAGTGTACACGGACATGTGGGTGGAACCTGAGGCAGCTGCCTACGCACCACCTCCACCAGCCAAAAAGC
>seq-317-52__TRD_UNSEG
>seq-317-52__UNSEG
CTGTTAACTACTGTACAACCCGACTTCATAATGGTGCTTTCAAACAGCGAGATGAGTAAAAACATCAGCTTCCACGTTGCCTTCTGCGCAAAGGGTTTCACCAAGGATGGAGAAAGGGAGACAGCTTGCAGATGGCGCGT
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment