Commit fc54dea6 authored by aomietanski's avatar aomietanski

Test modifications to pass build tests

parent 0a51b212
Pipeline #24915 passed with stage
in 4 seconds
......@@ -7,4 +7,4 @@ $ Affectation for sequence YYGGGYYACGYAYAGCGGYGYTTYYCCTYTYTGYTYTGCYAAAYAACYYYYTG
1:VDJ 1 95 100 105 107 134
$ Percentage for sequence GGAGTCGGGGGAGGCTTGGTACAGCCTGGCAGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTTGATGATTATGCCATGCACTGGGTCCGGCAAGCTCCAGGGAAGGGCCTGGAGTGGGTCTCAGGTATTAGTTGGAATAGTGGTAGCATAGGCTATGCGGACTCTGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCCCTGTATCTGCAAATGAACAGTCTGAGAGCTGAGGACACGGCCTTGTATTACTGTGCACCCGGAGGTATGGACGTCTGGGGCCAAGGGACCCTGGTCACC
0.304534313725
1:IGHV3-9.01 7/CCCGGA/17 IGHJ6.02 .* percentage=0.304534313725
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment