Commit f9b86544 authored by Mathieu Giraud's avatar Mathieu Giraud

germline, add a simple test on Gallus Gallus germline

link to #3910
parent 5b626cc6
Pipeline #79813 passed with stages
in 14 minutes and 3 seconds
!NO_LAUNCHER:
!LAUNCH: (cd $VIDJIL_DIR/germline ; cat gallus-gallus/IGHV.fa | tr '|' '#' )
$ Found sequence of Gallus gallus Red Jungle fowl
1: .*#IGHV1-1.01#Gallus gallus_Red Jungle fowl#
$ Found sequence of Gallus gallus
1: .*#IGHV1-21.*#Gallus gallus#
$ Found a sequence part of IGHV1-1*01
i1: tgggtgcgacaggcgcccggcaaggggctggagtgggtcgctggtattggcagcagt
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment