Commit f97bbfba authored by Mathieu Giraud's avatar Mathieu Giraud

germline/split-from-imgt.py: custom 118 positions for some manually curated J sequences

parent 269dafff
......@@ -115,6 +115,17 @@ MAX_GAP_J = 36 # maximal position of Phe/Trp (36 for TRAJ52*01)
PHE_TRP_WARN_SIZE = 15 # small sequences are on a second line
PHE_TRP_WARN_MSG = 'No Phe/Trp-Gly-X-Gly pattern'
CUSTOM_118 = { '': 0 # custom position of 118 in sequences without the Trp-Gly-X-Gly pattern
# 118
# |..
, 'gcacatgtttggcagcaagacccagcccactgtctta': 8 # IGLJ-C/OR18*01
, 'ggttttcagatggccagaagctgctctttgcaaggggaaccatgttaaaggtggatctta': 27 # TRAJ16*01
, 'agatgcgtgacagctatgagaagctgatatttggaaaggagacatgactaactgtgaagc': 30 # TRAJ51*01
, 'ggtaccgggttaataggaaactgacatttggagccaacactagaggaatcatgaaactca': 27 # TRAJ61*01
, 'ataccactggttggttcaagatatttgctgaagggactaagctcatagtaacttcacctg': 24 # TRGJP1*01
, 'atagtagtgattggatcaagacgtttgcaaaagggactaggctcatagtaacttcgcctg': 24 # TRGJP2*01
}
def gap_j(seq):
'''Gap J sequences in order to align the Phe118/Trp118 codon'''
m = j118.search(seq)
......
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment