Commit f9618b14 authored by Mikaël Salson's avatar Mikaël Salson Committed by Mathieu Giraud

germline/tests/should-get-tests: Case insensitive sequence comparison

parent 50e9521b
......@@ -2,4 +2,4 @@
!LAUNCH: (cd $VIDJIL_DIR/germline ; grep -A2 -F 'IGHD2-2*02' homo-sapiens/IGHD+up.fa | tr -d '\n')
$ Correct sequence, with upstream
1:AGGATTTTGTGGGGGCTCGTGTCACTGTGA
i1:AGGATTTTGTGGGGGCTCGTGTCACTGTGA
......@@ -5,4 +5,4 @@ $ Correct full header, with TRDD2*01 identifier between pipes
f1: .*#TRDD2.01#.*Human T-cell receptor germline delta-chain D-region DNA
$ Correct sequence, with upstream
1: AAGAGGGTTTTTATACTGATGTGTTTCATTGTGCCTTCCTAC
i1: AAGAGGGTTTTTATACTGATGTGTTTCATTGTGCCTTCCTAC
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment