Commit f56d37e6 authored by flothoni's avatar flothoni

Cdr3 roductive, add a test on a sequence that is see as non-productive by vidjil

link to #2526
parent d2500ac5
Pipeline #70486 failed with stages
in 9 minutes and 39 seconds
# productive
>IGHV3-33*01 0/CCTGAGT/7 IGHD3-10*01 8/TCGA/16 IGHJ4*02
ACCATGGAGTTTGGGCTGAGAGGGGTTTTCCTCGTTGCTCTTTTAAGAGGTGATTCATGGAGAAATAGAGAGACTGAGTGTGAGTGAACATGAATGAGAAAAACTGGATTTGTGTGGCATTTGCTGATAACGGTGTCCTTCTGTTTGCAGGTGTCCAGTGTCAGGTTCAACTGGTGGAGTCTGGGGGAGGCGTGGTCCAGCCTGGGACGTCCCTGAGACTCTCCTGTGTAGCCTCTGGATTCACCTTCAGGCATTATGGTTTCCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCAATTATCTGGTCTGATGGAAGTAAAAGATACTATGCAGACTCCGTGAGGGGCCGATTCACCATCTCCAGAGACGATTCCGACTACACGCTGTATCTACAAATGAACAGTCTGACAGCCGAGGACACGGCTGTGTATTATTGTGCGAGAGACCTGAGTTATGGTTCGGGGAGTTTCGAGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGT
\ No newline at end of file
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -c designations -3 -g $VIDJIL_DIR/germline/homo-sapiens.g:TRG $VIDJIL_DATA/cdr3-productive.fa
!OUTPUT_FILE: out/cdr3-productive.vidjil
$ But only one productive
1: "productive": true
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment