Commit f45a2761 authored by Mathieu Giraud's avatar Mathieu Giraud

doc/vidjil-algo.md: properly format example code

`diff` seems better than `example`.
We should have a better look on pygments.
parent 3141981e
......@@ -248,7 +248,8 @@ clustering.
## Recombination / locus selection
``` example
``` diff
Germline presets (at least one -g or -V/(-D)/-J option must be given for all commands except -c germlines)
-g <.g file>(:filter)
multiple locus/germlines, with tuned parameters.
......@@ -292,7 +293,7 @@ Finally, the advanced `-V/(-D)/-J` options enable to select custom V, (D) and J
## Main algorithm parameters
``` example
``` diff
Window prediction
(use either -s or -k option, but not both)
-s <string> spaced seed used for the V/J affectation
......@@ -362,7 +363,7 @@ The default is `-t 0`.
The following options control how many clones are output and analyzed.
``` example
``` diff
Limits to report a clone (or a window)
-r <nb> minimal number of reads supporting a clone (default: 5)
-% <ratio> minimal percentage of reads supporting a clone (default: 0)
......@@ -424,7 +425,7 @@ even if those sequences are 'rare' (below the `-r/-%` thresholds).
Such sequences can be provided either with `-W <sequence>`, or with `-l <file>`.
The file given by `-l` should have one sequence by line, as in the following example:
``` example
``` diff
GAGAGATGGACGGGATACGTAAAACGACATATGGTTCGGGGTTTGGTGCT my-clone-1
GAGAGATGGACGGAATACGTTAAACGACATATGGTTCGGGGTATGGTGCT my-clone-2 foo
```
......@@ -521,7 +522,7 @@ By default, the two output files are named `out/basename.vidjil` in `out/basenam
The `out/basename.windows.fa` file contains the list of windows, with number of occurrences:
``` example
``` diff
>8--window--1
TATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTG
>5--window--2
......@@ -536,7 +537,7 @@ The first window has 8 occurrences, the second window has 5 occurrences.
The `out/seq/clone.fa-*` contains the detailed analysis by clone, with
the window, the consensus sequence, as well as with the most similar V, (D) and J germline genes:
``` example
``` diff
>clone-001--IGH--0000008--0.0608%--window
TATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTG
>clone-001--IGH--0000008--0.0608%--lcl|FLN1FA001CPAUQ.1|-[105,232]-#2 - 128 bp (55% of 232.0 bp) + VDJ 0 54 73 84 85 127 IGHV3-23*05 6/ACCCGGGAGGAACAATAT/9 IGHD6-13*01 0//5 IGHJ4*02 IGH SEG_+ 1.946653e-19 1.352882e-19/5.937712e-20
......@@ -651,7 +652,7 @@ Segmentations of V(D)J recombinations are displayed using a dedicated
`.vdj` format. This format is compatible with FASTA format. A line starting
with a \> is of the following form:
``` example
``` diff
>name + VDJ startV endV startD endD startJ endJ Vgene delV/N1/delD5' Dgene delD3'/N2/delJ Jgene comments
name sequence name (include the number of occurrences in the read set and possibly other information)
......@@ -692,7 +693,7 @@ this case a valid FASTA file.
For VJ recombinations the output is similar, the fields that are not
applicable being removed:
``` example
``` diff
>name + VJ startV endV startJ endJ Vgene delV/N1/delJ Jgene comments
```
......
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment