Commit ecffd703 authored by Mikaël Salson's avatar Mikaël Salson

Merge branch 'feature-tc/improve_doc' into 'dev'

Feature tc/improve doc

See merge request !500
parents e021dadc edf7cd83
Pipeline #88165 passed with stage
in 6 seconds
......@@ -72,9 +72,9 @@ or `clusters`, to further cluster some clones, see below).
"top": 1,
"seg":
{
"5": {"name": "TRGV5*01", "start": 1, "stop": 86, "delRight":5},
"5": {"name": "TRGV5*01", "start": 1, "stop": 87, "delRight":5},
"3": {"name": "TRGJ1*02", "start": 89, "stop": 118, "delLeft":0},
"cdr3": { "start": 77, "stop": 104, "seq": "gccacctgggccttattataagaaactc" }
"cdr3": { "start": 78, "stop": 105, "seq": "gccacctgggccttattataagaaactc" }
}
}
......@@ -119,7 +119,7 @@ do a correct gathering.
"top": 1,
"seg":
{
"5": {"name": "TRGV5*01", "start": 1, "stop": 86, "delRight": 5},
"5": {"name": "TRGV5*01", "start": 1, "stop": 87, "delRight": 5},
"3": {"name": "TRGJ1*02", "start": 89, "stop": 118, "delLeft": 0}
}
},
......@@ -318,6 +318,8 @@ In the `.analysis` file, this section is intended to describe some specific clon
//
// JUNCTION//CDR3 should be stored that way (in fields called "junction" of "cdr3"),
// its productivity must be stored in a boolean field called "productive".
// "seq" field should not be filled for cdr3 or junction (it is extracted from the sequence itself).
// However a "aa" field may be used to give the amino-acid translation of the cdr3 or junction.
"somefeature": { "start": 56, "stop": 61, "seq": "ACTGTA", "val": 145.7, "info": "analyzed with xyz" },
// Numerical or textual features concerning all the sequence or its analysis (such as 'evalue')
......
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment