Commit eb27a50f authored by Mathieu Giraud's avatar Mathieu Giraud

demo/Demo-X5.fa: moved to demo/, link back inside should-vdj-tests/

See #2635.
parent f7c71baf
### IGH: VDJ, DJ
# 0147-lil-IGH-TRG
>IGHV3-74*02 7/CCGCGGT/6 IGHD3-9*01 4/CTTCGAACA/7 IGHJ4*02 [IGH]
GGAGTCGGGGGGAGGCTTAGTTCAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAGCTACTGGATGCACTGGGTCCGCCAAGCTCCAGGGAAGGGGCTGGTGTGGGTCTCACGTATTAATAGTGATGGGAGTAGCACAAGCTACGCGGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACACGCTGTATCTGCAAATGAACAGTCTGAGAGCCGAGGACACGGCTGTGTATTACTGCCGCGGTCGATATTTTGACTGGTTATTACTTCGAACATGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGT
# 0215-ren-IGH+
>IGHD6-13*01 8/TCCCCCCCCCCT/6 IGHJ1*01 [IGH+]
ATACGAGATATGGACAGATTACGGTAGCAGAGACTTGGTCTTGACCCCAGCAAGGGAAGGCCCCCAAACAGACCAGGAGGTTTCTGAAGGTGTCTGTGTCACAGTGGGGTATAGCAGCA
TCCCCCCCCCCT
TACTTCCAGCACTGGGGCCAGGGCACCCTGGTCACCGTCTCCTCAGGTAAG
### IGK: VJ, V-KDE, Intron-KDE
# 1043-IGK
>IGKV1-5*03 9/4/1 IGKJ1*01 [IGK] {CQQYNRLWTF}
CTCCTGCTACTCTGGCTCCCAGGTGCCAAATGTGACATCCAGATGACCCAGTCTCCTTCCACCCTGTCTGCGTCTGTAGGAGACAGAGTCACCATCACCTGCCGGGCCAGTCAGAGTATTAATAACAACTTGGCCTGGTATCAGGAGAAGCCAGGGAAAGCCCCTAAGGTCCTGATCTATAAGGCGTCTAGTTTAGAAAGTGGGGTCCCATCAAGGTTCAGCGGCAGTGGATCTGGGACAGAATTCACTCTCACCATCAGCAGCCTGCAGCCTGATGATTTTGCAACCTATTACTGCCAACAATATAATAGACTTTGGACGTTCGGCCAAGGGACCAAGGTGGAAGTCAAACGAACTGTGGCTGCACCATCT
# 0119-lil-IGK+-TRA+D-TRD+-TRG
>Intron 2/0/9 KDE [IGK+]
CGTGGCACCGCGAGCTGTAGACAGAGCCGCGGTCTTTCTCGATTGAGTGGCTTTGGTGGCCATGCCACCGCGCTCTTGGGGCAGCCGCCTTGCCGCTAGTGGCCGTGGCCACCCTGTGTCTGCCCGATTGATGCTGCCGTAGCCAGCTTTCCTGAGTGGCAGCCCAGGGCGACTCCTCATGAGTCTGCAGCTGCATTTTTGCCATATCCACTATTTGGAGTCTGACCTCCCTAGGAAGCCTCCCTGCTCCCTAGGACAACCTGCTCTGACCTCTGAGG
# 0119-lil-IGK+-TRA+D-TRD+-TRG
>IGKV3-7*04 1/GTGGA/11 KDE [IGK+]
CCCAGGCTCCTCATCTATGATGCATCCACCAGGGCCACTAGCATCCCAGCCAGGTTCAGTGGCAGTGGGTCTGGGACAGACTTCACTCTCACCATCAGCAGCCTGCAGCCTGAAGATTTTGCAGTTTATTACTGTCAGCAGGATTATAACTTACCTCGTGGAGGCAGCCCAGGGCGACTCCTCATGAGTCTGCAGCTGCATTTTTGCCATATCCACTATTTGGAGTCTGACCTCCCTAGGAAGCCTCCCTGCTCCCTAGGACAACCTGCTCTGACCTCTGAGG
### IGL
# 1043-IGL
>IGLV2-14*01 12/4/0 IGLJ3*02 [IGL]
GGTCCTGGGCCCAGTCTGCCCTGACTCAGCCTGCCTCCGTGTCTGGGTCTCCTGGACAGTCGATCACCATCTCCTGCACTGGAACCAGCAGTGACGTTGGTGGTTATAACTATGTCTCCTGGTACCAACAGCACCCAGGCAAAGCCCCCAAACTCATGATTTATGAGGTCAGTAATCGGCCCTCAGGGGTTTCTAATCGCTTCTCTGGCTCCAAGTCTGGCAACACGGCCTCCCTGACCATCTCTGGGCTCCAGGCGAGGACGAGGCTGATTATTACTGCAGCTCATATACAAGCTTTCTTGGGTGTTCGGCGGAGGGACCAAGCTG
### TRA
# artificial sequence
>TRAV1-1*01 0//0 TRAJ1*01 [TRA]
tcttcattccttagtcgctctgatagttatggttacctccttctacaggagctccagatg
aaagactctgcctcttacttctgcgctgtgagaga
gtatgaaagtattacctcccagttgcaatttggcaaaggaaccagagtttccacttctcc
### TRB: VJ, DJ
# 0000-nck-TRB
>TRBV11-2*01 1/4/0 TRBJ2-7*01 [TRB] {CASSLGPSYEQYF}
AACGGTGTAGTGGATGATTCACAGTTGCCTAAGGATCGATTTTCTGCAGAGAGGCTCAAAGGAGTAGACTCCACTCTCAAGATCCAGCCTGCAAAGCTTGAGGACTCGGCCGTGTATCTCTGTGCCAGCAGCTTAGGTCCCTCGTACGAGCAGTACTTCGGGCCGGGCACCAGGCTC
# 0000-nck-TRB+
>TRBD2*02 8/10/2 TRBJ2-7*01 [TRB+]
CTGCGCTTCCTGCCGCTGCCcaGTGGTTGGGGGAGGGGGACtaGCAGGGAGGAAACATTTTTGTATcaTGGTGTAACATTGTGGGGACTAGTGTCAGTCCCCCTACGAGCAGTACTTCGGGCCGGGCACCAGGCTCACGGTTACAGGTAAGA
### TRG
# 0000-lil-lec-TRG
>TRGV10*02 5/AGAC/3 TRGJP1*01 [TRG] {CAAWRPTGWFKIF}
ATCCTTACCATCAAGTCCGTAGAGAAAGAAGACATGGCCGTTTACTACTGTGCTGCGTGGAGACCCACTGGTTGGTTCAAGATATTTGCTGAAGGGACTAAGCTCATAGTAACTT
### TRD: VDDJ, Dd2-Dd3, Vd-Ja
# 0000-nck-TRD+-VDDJ
>TRDV1*01 2/TCTCGAT/2 TRDD2*01 0/CGT/0 TRDD3*01 3/CTCGGG/0 TRDJ1*01 [TRD]
CAAAAAGTGGTCGCTATTCTGTCAACTTCAAGAAAGCAGCGAAATCCGTCGCCTTAACCATTTCAGCCTTACAGCTAGAAGATTCAGCAAAGTACTTTTGTGCTCTTGGGGAATCTCGATTTCCTACCGTACTGGGGGATCTCGGGACACCGATAAACTCATCTTTGGAAAAGGAACCCGTGTGACTGTGGAAC
# 0000-nck-TRD+
>TRDD2 1/3/15 TRDD3 [TRD+]
Agcgggtggtgatggcaaagtgccaaggaaagggaaaaaggaagaagagggtttttatactgatgtgttt
CattgtgCCTTCCTATGG
cagtgctacaaaacctacagagacctgtacaaaaactgcaggggcaaaagtgccatttccctgggatatcctcaccctgggtcccatgcctcaggagacaaacacagcaagcagcttccctc
# 0000-nck-TRD+
>TRDV2 0/7/0 TRDD3 [TRD+]
GAAtcGAtAttGCAAAGAACCtGGCtGtACttAAGatACttGCACCAtCAGaGaGaGAtGAAGgGtCttACtACtGtGCCtGtGACACCCCCCtGTACtGGGGGAtACGCACAGtGCtACAAAACCtACAGAGACCtGTACAAAAACtGCAGGGGCAAAAGtGCCATttCCCtGGGAtAtCCtCACCCtGGGTCCCAA
# 0444-lil-TRA+D
>TRDV1*01 5//3 TRDD2*01 1//7 TRAJ29*01 [TRA+D] BUG
AGCGGGTGGTGATGGCAAATGCCAAGGAAGGGAAAAGGAAGAAGAGGGTTTTTATACTGATGTGTTTCATTGTGGGCACAGTGCTACAAAACCTACAGAGACCTGTACAAAAACTGCAGGGGCAAAAGTGCCATTTCCCTGGGATATCCTCACCCTGGTCCCAATGCAAAAAGTGGTCGCTATTCTGTCAACTTCAAGAAAGCAGCGAAATCCGTCGCCTTAACCATTTCAGCCTTACAGCTAGAAGATTCAG
CAAAGTACTTTTGTGCTCTTGGGTCCTAAGGAAACACACCTCTTGTCTTTGGAAAGGGCACAAGACTTTCTGTGATTGCAAGTAAGTGTTTCTAGCCATCCTTGATTTTGATCAGCAATGGCTTCTTCCCTTGAATTATTTTTCAGTGTACCTAGAATGCTTTTGCC
../../../demo/Demo-X5.fa
\ No newline at end of file
### IGH: VDJ, DJ
# 0147-lil-IGH-TRG
>IGHV3-74*02 7/CCGCGGT/6 IGHD3-9*01 4/CTTCGAACA/7 IGHJ4*02 [IGH]
GGAGTCGGGGGGAGGCTTAGTTCAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAGCTACTGGATGCACTGGGTCCGCCAAGCTCCAGGGAAGGGGCTGGTGTGGGTCTCACGTATTAATAGTGATGGGAGTAGCACAAGCTACGCGGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACACGCTGTATCTGCAAATGAACAGTCTGAGAGCCGAGGACACGGCTGTGTATTACTGCCGCGGTCGATATTTTGACTGGTTATTACTTCGAACATGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGT
# 0215-ren-IGH+
>IGHD6-13*01 8/TCCCCCCCCCCT/6 IGHJ1*01 [IGH+]
ATACGAGATATGGACAGATTACGGTAGCAGAGACTTGGTCTTGACCCCAGCAAGGGAAGGCCCCCAAACAGACCAGGAGGTTTCTGAAGGTGTCTGTGTCACAGTGGGGTATAGCAGCA
TCCCCCCCCCCT
TACTTCCAGCACTGGGGCCAGGGCACCCTGGTCACCGTCTCCTCAGGTAAG
### IGK: VJ, V-KDE, Intron-KDE
# 1043-IGK
>IGKV1-5*03 9/4/1 IGKJ1*01 [IGK] {CQQYNRLWTF}
CTCCTGCTACTCTGGCTCCCAGGTGCCAAATGTGACATCCAGATGACCCAGTCTCCTTCCACCCTGTCTGCGTCTGTAGGAGACAGAGTCACCATCACCTGCCGGGCCAGTCAGAGTATTAATAACAACTTGGCCTGGTATCAGGAGAAGCCAGGGAAAGCCCCTAAGGTCCTGATCTATAAGGCGTCTAGTTTAGAAAGTGGGGTCCCATCAAGGTTCAGCGGCAGTGGATCTGGGACAGAATTCACTCTCACCATCAGCAGCCTGCAGCCTGATGATTTTGCAACCTATTACTGCCAACAATATAATAGACTTTGGACGTTCGGCCAAGGGACCAAGGTGGAAGTCAAACGAACTGTGGCTGCACCATCT
# 0119-lil-IGK+-TRA+D-TRD+-TRG
>Intron 2/0/9 KDE [IGK+]
CGTGGCACCGCGAGCTGTAGACAGAGCCGCGGTCTTTCTCGATTGAGTGGCTTTGGTGGCCATGCCACCGCGCTCTTGGGGCAGCCGCCTTGCCGCTAGTGGCCGTGGCCACCCTGTGTCTGCCCGATTGATGCTGCCGTAGCCAGCTTTCCTGAGTGGCAGCCCAGGGCGACTCCTCATGAGTCTGCAGCTGCATTTTTGCCATATCCACTATTTGGAGTCTGACCTCCCTAGGAAGCCTCCCTGCTCCCTAGGACAACCTGCTCTGACCTCTGAGG
# 0119-lil-IGK+-TRA+D-TRD+-TRG
>IGKV3-7*04 1/GTGGA/11 KDE [IGK+]
CCCAGGCTCCTCATCTATGATGCATCCACCAGGGCCACTAGCATCCCAGCCAGGTTCAGTGGCAGTGGGTCTGGGACAGACTTCACTCTCACCATCAGCAGCCTGCAGCCTGAAGATTTTGCAGTTTATTACTGTCAGCAGGATTATAACTTACCTCGTGGAGGCAGCCCAGGGCGACTCCTCATGAGTCTGCAGCTGCATTTTTGCCATATCCACTATTTGGAGTCTGACCTCCCTAGGAAGCCTCCCTGCTCCCTAGGACAACCTGCTCTGACCTCTGAGG
### IGL
# 1043-IGL
>IGLV2-14*01 12/4/0 IGLJ3*02 [IGL]
GGTCCTGGGCCCAGTCTGCCCTGACTCAGCCTGCCTCCGTGTCTGGGTCTCCTGGACAGTCGATCACCATCTCCTGCACTGGAACCAGCAGTGACGTTGGTGGTTATAACTATGTCTCCTGGTACCAACAGCACCCAGGCAAAGCCCCCAAACTCATGATTTATGAGGTCAGTAATCGGCCCTCAGGGGTTTCTAATCGCTTCTCTGGCTCCAAGTCTGGCAACACGGCCTCCCTGACCATCTCTGGGCTCCAGGCGAGGACGAGGCTGATTATTACTGCAGCTCATATACAAGCTTTCTTGGGTGTTCGGCGGAGGGACCAAGCTG
### TRA
# artificial sequence
>TRAV1-1*01 0//0 TRAJ1*01 [TRA]
tcttcattccttagtcgctctgatagttatggttacctccttctacaggagctccagatg
aaagactctgcctcttacttctgcgctgtgagaga
gtatgaaagtattacctcccagttgcaatttggcaaaggaaccagagtttccacttctcc
### TRB: VJ, DJ
# 0000-nck-TRB
>TRBV11-2*01 1/4/0 TRBJ2-7*01 [TRB] {CASSLGPSYEQYF}
AACGGTGTAGTGGATGATTCACAGTTGCCTAAGGATCGATTTTCTGCAGAGAGGCTCAAAGGAGTAGACTCCACTCTCAAGATCCAGCCTGCAAAGCTTGAGGACTCGGCCGTGTATCTCTGTGCCAGCAGCTTAGGTCCCTCGTACGAGCAGTACTTCGGGCCGGGCACCAGGCTC
# 0000-nck-TRB+
>TRBD2*02 8/10/2 TRBJ2-7*01 [TRB+]
CTGCGCTTCCTGCCGCTGCCcaGTGGTTGGGGGAGGGGGACtaGCAGGGAGGAAACATTTTTGTATcaTGGTGTAACATTGTGGGGACTAGTGTCAGTCCCCCTACGAGCAGTACTTCGGGCCGGGCACCAGGCTCACGGTTACAGGTAAGA
### TRG
# 0000-lil-lec-TRG
>TRGV10*02 5/AGAC/3 TRGJP1*01 [TRG] {CAAWRPTGWFKIF}
ATCCTTACCATCAAGTCCGTAGAGAAAGAAGACATGGCCGTTTACTACTGTGCTGCGTGGAGACCCACTGGTTGGTTCAAGATATTTGCTGAAGGGACTAAGCTCATAGTAACTT
### TRD: VDDJ, Dd2-Dd3, Vd-Ja
# 0000-nck-TRD+-VDDJ
>TRDV1*01 2/TCTCGAT/2 TRDD2*01 0/CGT/0 TRDD3*01 3/CTCGGG/0 TRDJ1*01 [TRD]
CAAAAAGTGGTCGCTATTCTGTCAACTTCAAGAAAGCAGCGAAATCCGTCGCCTTAACCATTTCAGCCTTACAGCTAGAAGATTCAGCAAAGTACTTTTGTGCTCTTGGGGAATCTCGATTTCCTACCGTACTGGGGGATCTCGGGACACCGATAAACTCATCTTTGGAAAAGGAACCCGTGTGACTGTGGAAC
# 0000-nck-TRD+
>TRDD2 1/3/15 TRDD3 [TRD+]
Agcgggtggtgatggcaaagtgccaaggaaagggaaaaaggaagaagagggtttttatactgatgtgttt
CattgtgCCTTCCTATGG
cagtgctacaaaacctacagagacctgtacaaaaactgcaggggcaaaagtgccatttccctgggatatcctcaccctgggtcccatgcctcaggagacaaacacagcaagcagcttccctc
# 0000-nck-TRD+
>TRDV2 0/7/0 TRDD3 [TRD+]
GAAtcGAtAttGCAAAGAACCtGGCtGtACttAAGatACttGCACCAtCAGaGaGaGAtGAAGgGtCttACtACtGtGCCtGtGACACCCCCCtGTACtGGGGGAtACGCACAGtGCtACAAAACCtACAGAGACCtGTACAAAAACtGCAGGGGCAAAAGtGCCATttCCCtGGGAtAtCCtCACCCtGGGTCCCAA
# 0444-lil-TRA+D
>TRDV1*01 5//3 TRDD2*01 1//7 TRAJ29*01 [TRA+D] BUG
AGCGGGTGGTGATGGCAAATGCCAAGGAAGGGAAAAGGAAGAAGAGGGTTTTTATACTGATGTGTTTCATTGTGGGCACAGTGCTACAAAACCTACAGAGACCTGTACAAAAACTGCAGGGGCAAAAGTGCCATTTCCCTGGGATATCCTCACCCTGGTCCCAATGCAAAAAGTGGTCGCTATTCTGTCAACTTCAAGAAAGCAGCGAAATCCGTCGCCTTAACCATTTCAGCCTTACAGCTAGAAGATTCAG
CAAAGTACTTTTGTGCTCTTGGGTCCTAAGGAAACACACCTCTTGTCTTTGGAAAGGGCACAAGACTTTCTGTGATTGCAAGTAAGTGTTTCTAGCCATCCTTGATTTTGATCAGCAATGGCTTCTTCCCTTGAATTATTTTTCAGTGTACCTAGAATGCTTTTGCC
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment