Commit e975cf28 authored by Thonier Florian's avatar Thonier Florian

fuse.py; Add a clone for doctest

Link to #3944
parent 5429d503
......@@ -656,6 +656,35 @@ w5.d ={"id" : "aaa", "reads" : [5], "top" : 3 }
w6 = Window(1)
w6.d ={"id" : "bbb", "reads" : [12], "top" : 2 }
seg_w7 = {
"germline": "TRA",
"id": "TTCTTACTTCTGTGCTACGGACGCCGGGGCTCAGGAACCTACAAATACAT",
"name": "TRAV17*01 0/CCGGGG/5 TRAJ40*01",
"reads": [
16
],
"seg": {
"3": {
"delLeft": 5,
"name": "TRAJ40*01",
"start": 112
},
"5": {
"delRight": 0,
"name": "TRAV17*01",
"stop": 105
},
"N": 6,
"cdr3": {
"aa": "ATDAG#SGTYKYI",
"start": 96,
"stop": 133
}
},
"sequence": "GTGGAAGATTAAGAGTCACGCTTGACACTTCCAAGAAAAGCAGTTCCTTGTTGATCACGGCTTCCCGGGCAGCAGACACTGCTTCTTACTTCTGTGCTACGGACGCCGGGGCTCAGGAACCTACAAATACATCTTTGGAACAG",
"top": 26
}
lw1 = ListWindows()
lw1.d["timestamp"] = 'ts'
lw1.d["reads"] = json.loads('{"total": [30], "segmented": [25], "germline": {}, "distribution": {}}', object_hook=lw1.toPython)
......@@ -814,9 +843,6 @@ def main():
jlist.build_stat()
jlist.filter(f)
w1 = Window(1)
w2 = Window(2)
w3 = w1+w2
print("\t", jlist, end=' ')
# Merge lists
......
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment