Commit e8e32a46 authored by Mathieu Giraud's avatar Mathieu Giraud

doc/algo.org: auxiliary output files, more documentation, -a

parent 48898847
......@@ -420,13 +420,13 @@ By default, the two output files are named =out/basename.vidjil= in =out/basenam
** Auxiliary output files
The auxiliary files include =out/basename.windows.fa= (list of windows, with number of occurrences, as below)
and =out/seq/clone.fa-*= (detailed analysis by clone).
The =out/basename.windows.fa= file contains the list of windows, with number of occurrences:
#+BEGIN_EXAMPLE
>8--window--1
ATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTGG
TATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTG
>5--window--2
CGAGAGGTTACTATGATAGTAGTGGTTATTACGGGGTAGGGCAGTACTAC
ATAGTAGTGGTTATTACGGGGTAGGGCAGTACTACTACTACTACATGGAC
(...)
#+END_EXAMPLE
......@@ -434,6 +434,28 @@ ATAGTAGTGGTTATTACGGGGTAGGGCAGTACTACTACTACTACATGGAC
Windows of size 50 (modifiable by =-w=) have been extracted.
The first window has 8 occurrences, the second window has 5 occurrences.
The =out/seq/clone.fa-*= contains the detailed analysis by clone, with
the window, the representative sequence, as well as with the most similar V, (D) and J germline genes:
#+BEGIN_EXAMPLE
>clone-001--IGH--0000008--0.0608%--window
TATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTG
>clone-001--IGH--0000008--0.0608%--lcl|FLN1FA001CPAUQ.1|-[105,232]-#2 - 128 bp (55% of 232.0 bp) + VDJ 0 54 73 84 85 127 IGHV3-23*05 6/ACCCGGGAGGAACAATAT/9 IGHD6-13*01 0//5 IGHJ4*02 IGH SEG_+ 1.946653e-19 1.352882e-19/5.937712e-20
GCTGTACCTGCAAATGAACAGCCTGCGAGCCGAGGACACGGCCACCTATTACTGT
ACCCGGGAGGAACAATATAGCAGCTGGTAC
TTTGACTTCTGGGGCCAGGGGATCCTGGTCACCGTCTCCTCAG
>IGHV3-23*05
GAGGTGCAGCTGTTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTTAGCAGCTATGCCATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCAGCTATTTATAGCAGTGGTAGTAGCACATACTATGCAGACTCCGTGAAGGGCCGGTTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCCGTATATTACTGTGCGAAA
>IGHD6-13*01
GGGTATAGCAGCAGCTGGTAC
>IGHJ4*02
ACTACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG
#+END_EXAMPLE
The =-a= debug option further output in each =out/seq/clone.fa-*= files the full list of reads belonging to this clone.
The =-a= option produces large files, and is not recommanded in general cases.
** Diversity measures
Several [[https://en.wikipedia.org/wiki/Diversity_index][diversity indices]] are reported, both on the standard output and in the =.vidjil= file:
......
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment