Commit e5b497cc authored by Mathieu Giraud's avatar Mathieu Giraud

tests: update

parent 17ef48f1
!LAUNCH: $VIDJIL_DIR/vidjil -A -G $VIDJIL_DIR/germline/TRG ./should-vdj-tests/ext-nucleotides-N.should-vdj.fa
!LAUNCH: $VIDJIL_DIR/vidjil -A -G $VIDJIL_DIR/germline/TRG ../should-vdj-tests/ext-nucleotides-N.should-vdj.fa
$ Segments on TRG
1: TRG .* -> .* 1
......
......@@ -2,7 +2,7 @@
!LAUNCH: $VIDJIL_DIR/vidjil -z 0 -w 60 -G $VIDJIL_DIR/germline/IGH $VIDJIL_DIR/data/Stanford_S22.fasta ; python $VIDJIL_DIR/tools/fuse.py out/Stanford_S22.vidjil out/Stanford_S22.vidjil -o out/fused.data ; cat out/fused.data | python $VIDJIL_DIR/tools/format_json.py -1
$ Points list
e1:"original_names": ["../../data/Stanford_S22.fasta", "../../data/Stanford_S22.fasta"]
e1:"original_names": ["../../..//data/Stanford_S22.fasta", "../../..//data/Stanford_S22.fasta"]
$ Most abundant window, twice, fused
1:"id": "CCACCTATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTGGGGCC".*"reads": \\[8, 8\\].*"top": 2
......
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment