Commit da462732 authored by Mikaël Salson's avatar Mikaël Salson

algo/tests/bugs/bug3009: Add sequence from #3009

Ensure that this sequence is properly analysed.
parent 757185a9
Pipeline #33008 canceled with stages
in 8 seconds
>TRDD2 28/CAA/2 TRDD3 [TRD+]
AGCGGGTGGTGATGGCAAAGTGCCAAGGAAAGGGAAAAAGGAAGAAGAGGGTTTTTATCAATGGGGGATACGCACAGTGCTACAAAACCTACAGAGACCTGTACAAAAACTGCAGGGGCAAAAGTGCCATTTCCCTGGGATATCCTCACCCTGGGTCCCA
!LAUNCH: $VIDJIL_DIR/$EXEC -e 1e-5 -g $VIDJIL_DIR/germline -r 1 bug3009.fa
$ Segmented as TRD+
1: TRD\+ -> 1
1: SEG_\+ -> 1
$ VDJ assignation
1:TRDD2.01 28/CAA/2 TRDD3.01
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment