Commit d854f215 authored by Mikaël Salson's avatar Mikaël Salson

should-vdj-tests/igl-largedel-j.should-vdj.fa: Correct test

Follows edd001ee: the downstream sequence was the one from IGHJ1 instead of IGLJ1.
parent 6c33abdd
Pipeline #65752 passed with stages
in 40 minutes and 18 seconds
>IGLV1-36*01 0//25 IGLJ1*01
cagtctgtgctgactcagccaccctcggtgtctgaagcccccaggcagagggtcaccatctcctgttctggaagcagctccaacatcggaaataatgctgtaaactggtaccagcagctcccaggaaaggctcccaaactcctcatctattatgatgatctgctgccctcaggggtctctgaccgattctctggctccaagtctggcacctcagcctccctggccatcagtgggctccagtctgaggatgaggctgattattactgtgcagcatgggatgacagcctgaatggtcc
gtcaccgtcctaggagtctgctgtctggggatagcggggagccaggtgtactg
\ No newline at end of file
gtcaccgtcctaggtaagtggctctcaacctttcccagcctgtctcaccctct
\ No newline at end of file
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment