Commit d4cd52a5 authored by Mikael Salson's avatar Mikael Salson

gosh-igh.should-vdj.fa: Improve chosen assignation

Therefore this sequence is not a bug anymore
parent 1f431153
Pipeline #32788 failed with stages
in 21 minutes and 14 seconds
......@@ -171,8 +171,14 @@ ATTAGACAAAAACCCCCTGGAATCATAGTATCAGCAGGAGAACTAGCCAGAGACAGCAAGAGGGGACTCAGTGACTCCCG
>IGHV3-13*01 5/6/0 IGHD7-27*01 1/16/11 IGHJ4*02 [IGH] BUG
GGAATGATCCTTCGTAGCTACGACATGCACTGGGTCCGCCAAGCTACAGGAAAAGGTCTGGAGTGGGTCTCAGCTATTGGTACTGCTGGTGACCCATACTATCCAGGCTCCGTGAAGGGCCGATTCACCATCTCCAGAGAAAATGCCAAGAACTCCTTGTATCTTCAAATGAACAGCCTGAGAGCCGGGGACACGGCTGTGTATTACTGTGCAGACACCCTAACTGGGGGGGGTTCCCTTGGGGGTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTAA
# IGHD2-2*01 GCGGGGACAGGAGGATTTTGTGGGGGCTCGTGTCACTGTGAGGATATTGTAGTAGTACCAGCTGCTATGCC
# |||||||||||||||||||||||||||||||||
# read CTGTGAGGATATTGTAGTAGTACCAGCTGTCATATTCGGGGATATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGGTCAAACC
# |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
# IGHD2-2*02 GCGGGGACAGGAGGATTTTGTGGGGGCTCGTGTCACTGTGAGGATATTGTAGTAGTACCAGCTGCTATACC |||||||||||||||||||||||||||||||||||||||||
# IGHJ6*02 ATTACTACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCT
#1334 dh2
>IGHD2-2*01 7/13/19 IGHJ6*02 [IGH+] BUG
>IGHD2-2*02 2/TTCGGGGA/19 IGHJ6*02 [IGH+]
ATTAGACAAACCCCCTGGAATCATAGTATCAGCAGGAGAACTAGCCAGAGACAGCAAGAGGGGACTCAGTGACTCCCGCGGGGACAGGAGGATTTTGTGGGGGCTCGTGTCACTGTGAGGATATTGTAGTAGTACCAGCTGTCATATTCGGGGATATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGGTCAAACC
#1334 dh3
......
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment