Commit d42e47b8 authored by Mikaël Salson's avatar Mikaël Salson

0215-ren-unseg.should-locus.fa: Formatting UNSEG

With the previous format the BUG keyword was ignored.
We also specify that the bug occurs at the locus level.
parent 2ef0f282
# PCR dimer (V4-K5), should not be segmented
#
>dimer__UNSEG BUG
>dimer [UNSEG] BUG-LOCUS
GAGCTCTGTGACCGCCGCGGACACGACTGGAGATTAAACGTAAGTGTAGAACCATGTCGTCAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAAAAA
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment