Commit d4247df9 authored by Mikael Salson's avatar Mikael Salson

tests: No CDR3 should be found on that sequence

Start and end of the junction are too close
parent 0027f326
!LAUNCH: $VIDJIL_DIR/vidjil -c segment -3 -g $VIDJIL_DIR/germline -i $DATA_DIR/no-cdr3.fasta
$ No CDR3 should be found
0:seq1.* IGH SEG.* [{].*[}]
......@@ -74,6 +74,7 @@ BASE=$(basename $file)
cd "$DIR"
VIDJIL_DIR=../../../
DATA_DIR=../../../data/
OUTPUT_DIR=.
TAP_FILE=${BASE%.*}.tap
LOG_FILE=${BASE%.*}.log
......
>seq1
GGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAGCTATAGCATGAACTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCATCCATTAGTAGTAGTAGTAGTTACATATACTACGCAGACTCAGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGAGGTGGTTATCCTTCCTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGT
\ No newline at end of file
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment