Commit d1d409aa authored by Mathieu Giraud's avatar Mathieu Giraud

Merge branch 'feature-a/update-TODOs' into 'dev'

Feature a/update TODOs

See merge request !257
parents 97cd77f1 505067e4
Pipeline #36116 passed with stages
in 44 seconds
!LAUNCH: $VIDJIL_DIR/$EXEC -s '#####-#####' -c clones -r 1 -g ../../../germline/homo-sapiens.g:IGH -t 0 -e 1 bug20160121.fa
$ Sequences should not be segmented since they only contain J.
f1:UNSEG only J/3' -> 2
1:UNSEG only J/3' -> 2
!LAUNCH: $VIDJIL_DIR/$EXEC -E 1 -d -g $VIDJIL_DIR/germline -c segment bug2249.fa
$ Should not have a TRDD2 (length 9) with 8 deletions (first seq)
fe0:7 TRDD2*01 1
f0:7 TRDD2.01 1
$ Should not have TRDD2 (length 9) with 12 deletions (second seq)
fe0:6 TRDD2*01 6
f0:6 TRDD2.01 6
$ Should not have IGHD5-24 (length 20) with 29 deletions
fe0:17 IGHD5-24*01 12
f0:17 IGHD5-24.01 12
$ Should not have VDDDJ
f0:VDDDJ
......@@ -6,7 +6,7 @@ $ Three clones should be found
# All clones should have a representative on 100% of the length
# Each regex should appear twice as it also appears in the similarity matrix.
$ Representative length of clone 1
$ Representative length of clone 1 (cf. #1541)
f2:clone1.*100% of
$ Representative length of clone 2
......
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -A -uU -g $VIDJIL_DIR/germline $VIDJIL_DATA/chimera-trg.fa
$ Do not segment on IGL by chance
f1:IGL .* -> .* 0
$ Do not segment on IG/TR by chance
12:(IG|TR).* -> .* 0
$ Report the sequence as AMBIGUOUS
f1:UNSEG ambiguous -> 1
# We are unable to report it as ambiguous yet as we are in the case where
# we have +J+J +V+V. The maximum point won't be in the middle, thus the
# V or J e-value will be high.
......@@ -17,5 +17,5 @@ $ First sequence, easy segmentation (no error, few deletions at the windows, sma
# Note that a second D (D3-16*01) can be detected (6 common nucleotides, or even 7 with an overlap on the first D)
# This is tested in segment_simul.should-vdj
$ seq1_polyT is the same as seq1 but starts and ends with 10Ts, the recombination is in the middle. start position should not be 0 and end position should not be length-1
$ seq1_polyT is the same as seq1 but starts and ends with 10Ts, the recombination is in the middle. start position should not be 0 and end position should not be length-1; See #2138
f1:^>seq1_polyT \\+ VDJ 11 83 88 100 105 150 IGHV5-10-1.0[1-4] 2/CTTC/3 IGHD1-14.01 1/GTTA/5 IGHJ5.01
# See #3003
# We launch three times a sequence of interest (buggy-D.fa) with a various
# number of distinct reads (mutations randomly inserted in the middle).
......
!REQUIRES: python $VIDJIL_DIR/tools/check_python_version.py
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -z 0 -w 60 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/Stanford_S22.fasta ; python $VIDJIL_DIR/tools/fuse.py out/Stanford_S22.vidjil out/Stanford_S22.vidjil -o out/fused.data ; cat out/fused.data | python $VIDJIL_DIR/tools/format_json.py -1
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -r 1 -z 0 -w 60 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/Stanford_S22.fasta ; python $VIDJIL_DIR/tools/fuse.py out/Stanford_S22.vidjil out/Stanford_S22.vidjil -o out/fused.data ; cat out/fused.data | python $VIDJIL_DIR/tools/format_json.py -1
$ Points list
1:"original_names": \[".*data//Stanford_S22.fasta", ".*data//Stanford_S22.fasta"\]
......@@ -7,6 +7,5 @@ $ Points list
$ Most abundant window, twice, fused
1:"id": "CCACCTATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTGGGGCC".*"reads": \[8, 8\].*"top": 2
# Fails since 49046ca6b97, no more 'others'
$ Windows that are not in the top 50
f1:"window": "others-1", .* "size": [ 12962, 12962 ]
$ Windows that are not in the bottom of the distribution
1: "distribution": \{[^}]+ "0.00001": \[9061, 9061\]
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment