Commit d05b8ed1 authored by Mathieu Giraud's avatar Mathieu Giraud

tests: --grep-reads

See #3785.
parent c06c7fc2
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -x 2000 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH --grep-reads GAGAGGTTACTATGATAGTAGTGGTTATTACGGGGTAGGGCAGTACTACT $VIDJIL_DATA/Stanford_S22.fasta ; cat out/seq/clone.fa-1
# See also label-grep-reads.should-get
$ Keep only one windows, the one given by -W, with only 2 reads in the first 2000 reads (it is actually the second clone in Stanford_S22.fasta)
1: keep 1 windows in 2 reads
$ Tbere are the three IGHV/D/J genes in out/seq/clone.fa-1
3:>IGH
$ There are 2 reads in out/seq/clone.fa-1
2:>lcl
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -x 2000 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH --out-reads --label-filter --label GAGAGGTTACTATGATAGTAGTGGTTATTACGGGGTAGGGCAGTACTACT $VIDJIL_DATA/Stanford_S22.fasta ; cat out/seq/clone.fa-1
# See also combo-grep-reads.should-get
$ Keep only one windows, the one given by -W, with only 2 reads in the first 2000 reads (it is actually the second clone in Stanford_S22.fasta)
1: keep 1 windows in 2 reads
......
......@@ -17,4 +17,4 @@ $ Display advanced options
: custom Cost
$ Correct number of options
B51:^ -
B52:^ -
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment