Commit d028ce42 authored by Mikael Salson's avatar Mikael Salson

should-vdj-tests: Add a test with constant gene in the sequence to check we detect it

See #2964
parent 8de435d8
Pipeline #120634 passed with stages
in 41 minutes and 34 seconds
>IGHV2-26*01 IGHJ4*02 [IGH]
TTCTCCACAGGGGTCTTGTCCCAGGTCACCTTGAAGGAGTCTGGTCCTGTACTGGTTAAACCCACAGAGACCCTCACGCTGACGTGCACCGTCTCTGGGTTCTCACTCAACAGTGCTAGAATGGGTGTGACCTGGATCCGTCAGTCCCCAGGGAAGGCCCTGGAATGGCTTGCACACATTTCCTCGAATGACGAAAAATTGTATAGTACATCTCTGAAGACCAGGCTCACCATCTCCAAGGACACCTCCAGAAGCCAGGTGGTCCTCACCGTGACCAACATGGACCCTGTGGACACAGCCACATATTACTGTGCACGGACAC
GGGGAGTATATAGTTATGATTCTC
TTGAGTACTGGGGCCAGGGAGCCCTGATCACCGTCTCCGCAGGGAGTGCATCCGCCCCAACCCTTTTCCCCCTCGTCTCCTGTGAGAATTCCCCGTC
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment