Commit cdf885c8 authored by Mathieu Giraud's avatar Mathieu Giraud

tests: update tests

Since 353497b7, both seq2 and seq4 are taken into account into this representative quality computation.
parent 28ae7780
......@@ -41,8 +41,8 @@ void testRepresentative() {
TAP_TEST(representative.sequence.length() == quality.length() ,TEST_KMER_REPRESENTATIVE_QUALITY,
"representative sequence length(" << representative.sequence.length() << ") and quality sequence length(" << quality.length() << ") must be equal");
TAP_TEST(quality == "!!!!!!!>--------<!!!" ,TEST_KMER_REPRESENTATIVE_QUALITY,
"representative quality sequence and seq2 quality must be the same for the required sequence");
TAP_TEST(quality == "!!!!!!!>-3------<!!!" ,TEST_KMER_REPRESENTATIVE_QUALITY,
"representative quality sequence is average between seq2 and seq4 for the required sequence (" << quality << " instead)");
krc.setRevcomp(false);
......
......@@ -5,7 +5,7 @@ ABCDEFGHIJKLMNOPQRSTUVWXYZABCDEFGHIJKLMNOP
@seq2
AAAACCCCCCCCCCGGGGGGGGGGTTTTTTTTTTATAGGGCGCGATCGACTTC
+
ABCDEFGHIJKLMNOPQRSTUVWXYZABCDEFGHIJ<-------->UVWXYZA
ABCDEFGHIJKLMNOPQRSTUVWXYZABCDEFGHIJ<------2->UVWXYZA
@seq3
GCGCGATCGACTTCTCGAGCATGTAGGCTACACGGTATAAAAAAAAAACCCCCCCCCCGGGGGGGGGGTTTTTT
+
......@@ -13,4 +13,4 @@ ABCDEFGHIJKLMNOPQRSTUVWXYZABCDEFGHIJKLMNOPQRSTUVWXYZABCDEFGHIJKLMNOPQRSTUV
@seq4
TATAGGGCGCGATCGACTTC
+
ABCDEFGHIJKLMNOPQRST
ABC<------4->NOPQRST
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment