Commit cd0d2609 authored by Mikael Salson's avatar Mikael Salson

bug: When adding some kmers prevent the sequence being segmented

When we have few kmers at the start, the sequence will be segmented
(because first_pos_max is at the start of the sequence).

On the contrary if we add some kmers of the same locus further in the sequence
(in our case it is TGCTCCCCTA) the sequence won't be segmented because
first_pos_max is much larger and it is likely that having so few kmers of the
locus in such a large sequence is obtained by chance.

Clearly there is a problem with the first sequence that should not be
segmented: maybe the evalue should not be computed from position 1 to position
1+first_pos_max ?
parent 38af32ff
>seq_IGHV_IGHJ
TGTGATGGATCATCtttttttttttttttttttttttttttttttttttttttttttttt
ttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttt
ttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttt
ttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttt
tttt
ATTACTACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCT
CA
>seq_IGHV_IGHJ2
TGTGATGGATCATCtttttttttttttttttttttttttttttttttttttttttttttt
ttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttt
ttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttt
ttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttt
TGTGATGGATC
tttt
ATTACTACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCT
CA
!LAUNCH: ../../../vidjil -s '#####-#####' -c clones -r 1 -G ../../../germline/IGH -t 0 -e 1 bug20160121.fa
$ Sequences should not be segmented since they only contain J.
1:UNSEG only J/3' -> 2
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment