Commit c77323f4 authored by Mathieu Giraud's avatar Mathieu Giraud

tests: data/trd-dd2-dd3.fa, include up/downstream regions

With 5bc753ee, we may fail at detecting short Dd2-Dd3 recombinations.
However, the original sequences in data/trd-dd2-dd3.fa were fairly artificial.
We now tag these sequences with TODO, and add up/downstream regions for the main tests.
parent 84e52850
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -A -g $VIDJIL_DIR/germline $VIDJIL_DIR/data/trd-dd2-dd3.fa
$ Segment only 2 reads, because there is no -i
1:junction detected in 2 reads .40..
1:junction detected in 2 reads
$ TRDV3*01-TRDD3*01 reported as "UNSEG only V/5'"
1:UNSEG only V/5' .*-> .* 1 .* 63
1:UNSEG only V/5' .*-> .* 2
$ TRDD2*01-TRDJ1*01 reported as "UNSEG only J/3'"
1:UNSEG only J/3' .*-> .* 1 .* 60
1:UNSEG only J/3' .*-> .* 2
$ TRDD2*01-TRDD3*01 reported as "UNSEG too few V/J"
1:UNSEG too few V/J.*-> .* 1 .* 22
1:UNSEG too few V/J.*-> .* 2
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -w 10 -e 10 -A -i -g $VIDJIL_DIR/germline $VIDJIL_DIR/data/trd-dd2-dd3.fa
$ Segment all 5 reads, thanks to -i
1:junction detected in 5 reads .100..
$ Segment 5 reads, thanks to -i
1:junction detected in 5 reads
$ 3 reads are segmented on TRD+ (with -w 10, otherwise the reads are too short)
1: TRD[+] .*->.* 3
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -e 10 -k 8 -w 20 -V $VIDJIL_DIR/germline/TRDV.fa -V $VIDJIL_DIR/germline/TRDD2_upstream.fa -J $VIDJIL_DIR/germline/TRDD3_downstream.fa -J $VIDJIL_DIR/germline/TRDJ.fa $VIDJIL_DIR/data/trd-dd2-dd3.fa
$ Segment all 5 reads, thanks to TRDD2 and TRDD3
1: junction detected in 5 reads .100..
$ Segment all 8 reads, thanks to TRDD2 and TRDD3
1: junction detected in 8 reads .100..
$ Find the good number of 20-windows
1: found 4 20-windows
1: found 5 20-windows
......@@ -2,18 +2,37 @@
gcaccatcagagagagatgaagggtcttactactgtgcctgtgacacc
acaccgataaactcatctttggaaaaggaacccgtgtgactgtggaaccaa
>TRDD2*01_0//0_TRDJ1*01 [TRD+]
>TRDD2*01_0//0_TRDJ1*01 [TRD+] TODO
ccttcctac
acaccgataaactcatctttggaaaaggaacccgtgtgactgtggaaccaa
>TRDD2*01_0//0_TRDD3*01 [TRD+]
# same sequence, with DD2 upstream
>TRDD2*01_0//0_TRDJ1*01 [TRD+]
TGTGTTTCATTGTGccttcctac
acaccgataaactcatctttggaaaaggaacccgtgtgactgtggaaccaa
>TRDD2*01_0//0_TRDD3*01 [TRD+] TODO
ccttcctac
actgggggatacg
>TRDV3*01_0//0_TRDD3*01 [TRD+]
# same sequence, with DD2 upstream and DD3 downstream
>TRDD2*01_0//0_TRDD3*01 [TRD+]
TGTGTTTCATTGTGccttcctac
actgggggatacgCACAGTGCTA
>TRDV3*01_0//0_TRDD3*01 [TRD+] TODO
atctctccagtaaggactgaagacagtgccacttactactgtgcctttag
actgggggatacg
# same sequence, with DD3 downstream
>TRDV3*01_0//0_TRDD3*01 [TRD+]
atctctccagtaaggactgaagacagtgccacttactactgtgcctttag
actgggggatacgCACAGTGCTA
>TRDV3*01_0//0_TRDJ4*01 [TRD]
atctctccagtaaggactgaagacagtgccacttactactgtgcctttag
ccagacccctgatctttggcaaaggaacctatctggaggtacaacaac
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment