Commit c5c781ec authored by Mathieu Giraud's avatar Mathieu Giraud

segment.cpp: remove delta_min check for FineSegmenter

The test was more harmful than useful.
Corrects what was identified as bug20150909.fa.
parent 523ecbbe
......@@ -744,11 +744,6 @@ FineSegmenter::FineSegmenter(Sequence seq, Germline *germline, Cost segment_c,
evalue = evalue_left + evalue_right ;
/* Unsegmentation causes */
if (Jstart - Vend < germline->delta_min)
{
because = UNSEG_BAD_DELTA_MIN ;
}
if (Vend == (int) string::npos)
{
evalue_left = BAD_EVALUE ;
......
# ./vidjil -g /Users/magiraud/vidjil/germline -A algo/tests/bugs/bug20150909.fa
# The sequences are segmented, but not fine-segmented (UNSEG < delta_min)
# The sequences are segmented, but the fine-segmentation details need to be checked
>TRGV9*01_6/C/29_TRGJ1*02__TRG
GACATAGCTACCTACTACTGTGCCTTGTGG
......
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment