Commit c54d7634 authored by Mathieu Giraud's avatar Mathieu Giraud

Merge branch 'feature-c/2465-fix-highlight-functional-test' into 'dev'

Fix highlight segmentation tests

Closes #2465

See merge request !288
parents 800324b3 c35d3973
Pipeline #40684 failed with stages
in 89 minutes and 44 seconds
......@@ -29,20 +29,21 @@ GGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAGCTACGACAT
$b.span(:id => "toIMGTSeg" ).click
$b.segmenter_checkbox_imgt_vdj.wait_until_present
Watir::Wait.until(timeout=10) { $b.span(:class => "identityBad").exists? }
clone_info = $b.clone_info_segmenter('0')
clone_info[:identity].element(:text => "NaN%").wait_while_present
productive_title = clone_info[:axis].element(:class => 'productivity-IMGT').title
assert (productive_title.include? 'productivity'), "IMGT should tell us the productivity of the sequence"
clone_segmenter = $b.clone_in_segmenter('0')
Watir::Wait.until(timeout=10) { $b.execute_script("return typeof model.clone(0).seg.imgt['N-REGION end']") != "undefined" }
$b.segmenter_checkbox_imgt_vdj.click
highlights = clone_segmenter.spans(:class => 'highlight_border')
assert (highlights.size >= 2 && highlights.size <= 3), "We should have the V(D)J genes highlighted, we had %d highlights" % highlights.size
for h in highlights
assert (h.style('width').to_i >= 100), "Highlights should have a reasonable width, found to be %s" % h.style('width')
end
clone_info[:identity].element(:text => "NaN%").wait_while_present
assert ((clone_info[:identity].text =~ /^[0-9\.]+%$/) == 0 ), "We should have identity rate (found: %s)" % clone_info[:identity].text
end
end
......
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment