Commit c1079464 authored by Mathieu Giraud's avatar Mathieu Giraud

tests: sequences outside any V(D)J locus

These sequences should be reported as "UNSEG too few V/J".
parent 0ce12ff5
!LAUNCH: ../../vidjil -g ../../germline ../../data/no-vdj.fa
$ No sequence is segmented
1: junction detected in 0 reads
$ The proper unsegmentation cause is given
1: UNSEG only V -> .* 0
1: UNSEG only J -> .* 0
1: UNSEG too few V/J -> .* 3
# Sequences outside any V(D)J locus
>nothing-1
CTAGGCATGGCTCCTCTCCACAGGAAAACTCCACTCCAGTGCTCAGCTTGCACCCTGGCACAGGCCAGCAGTTGCTGGAAGTCAGACACCTGAGAAGAAC
>nothing-2
GCCTCAGGCCAGCCTTCCGCTCCTTGAAGCTGGTCTCCGCACAGTGCTGGTTCCGTCACCCCCACCCAGGGAAGCAGGTCTGAGCAGCTTGTCCTGGCTG
>nothing-3
CACAGCTAGAGATCCTTTATTAAAAGCACACTGTTGGTTTCTGCTCAGTTCTTTATTGATTGGTGTGCCGTTTTCTCTGGAAGCCTCTTAAGAACACAGT
\ No newline at end of file
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment