Commit c0e8e2b5 authored by Mikaël Salson's avatar Mikaël Salson

should-vdj-tests: Checking #2314

The sequence is now correctly found as TRG.
parent fefa0fe9
Pipeline #34279 passed with stages
in 40 seconds
# TRGV10*01 ATGGCCGTTTACTACTGTGCTGCGTGGTGGGTGGC
# ||||||||||||||||||||||||| || || ||
# seq ATGGCCGTTTACTACTGTGCTGCGTCGTTGG-GGTTTT
# ||||||||||||||||||||||||| |
# TRGV10*02 ATGGCCGTTTACTACTGTGCTGCGTGGGATTA
>(TRGV10*01 4/GGTTT/7, TRGV10*01 1/TTT/7, TRV10*01 10/CGTTGGGGTTT/7, TRGV10*02 6/CGTTGGGGTTT/7) TRGJP1*01 [TRG]
AGCATGGGTAAGACAAGCAACAAAGTGGAGGCAAGAAAGAATTCTCAAACTCTCACTTCAATCCTTACCATCAAGTCCGTAGAGAAAGAAGACATGGCCGTTTACTACTGTGCTGCGTCGTTGG
GGTT
TTGGTTGGTTCAAGATATTTGCTGAAGGGACTAAGCTCATAGTAACTTCGCCTGGTAA
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment