Commit bc8c40e0 authored by Mathieu Giraud's avatar Mathieu Giraud

should-vdj-to-tap.py: mark as failed a test when there is an UNSEG

The only are .should-locus tests.
parent 034ac740
Pipeline #29882 passed with stage
in 4 seconds
......@@ -221,7 +221,7 @@ def should_result_to_tap(should_pattern, result, tap_id):
match = os.system("echo '%s' | grep -E '%s' > /dev/null 2>&1" \
% (result.replace("'", "'\\''"),
should_regex.pattern.replace("'", "'\\''")))
found = (match == 0)
found = (match == 0) and not ('UNSEG' in result)
globals()['global_stats'][locus] += 1
......
  • Je ne comprends pas pourquoi

  • Dans les rares cas où le FineSegmenter dit UNSEG (comme dans 941f8e6f), la sortie de vidjil-algo est :

    >IGHV3-23*01 IGHJ6 !  @42  @23  IGH UNSEG only J/3' 7.390463e+01 7.390183e+01/2.807806e-03
    GTAAAACGACGGCCAGTAGGTGCAGCTGGTGGAGTCGTATTAGGTCACCGTCTCCTCAGGTAAGCCCTATAGTGAGTCGTATTA

    Le IGHV3-23*01 IGHJ6 au début est... ce qui est dans le .should-vdj. Et jusqu'à avant ce commit ce test "passait" pour should-to-vdj.py. Ce commit permet que ce test soit bien en failed. Normalement les tests passent toujours sur dev (testé chez moi, https://gitlab.inria.fr/vidjil/vidjil/pipelines/29849 en cours).

  • (Et on a bien quelques tests qui disent qu'on doit trouver UNSEG, mais ce sont des .should-locus, traités par l'autre branche du if)

  • ok, merci

Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment