Commit ba6c57d0 authored by Thonier Florian's avatar Thonier Florian

fuse, update doctest

parent c24bba9c
Pipeline #84382 failed with stages
in 2 minutes and 26 seconds
......@@ -77,8 +77,13 @@ class Window:
>>> w1.get_values("top")
3
>>> w7 = Window(1)
>>> w7.d = seg_w7
>>> w7.d["seg"]["5"]["name"]
'TRAV17*01'
>>> w7.get_values("name")
'TRAV17*010/CCGGGG/5TRAJ40*01'
'TRAV17*01 0/CCGGGG/5 TRAJ40*01'
>>> w7.get_values("seg5")
'TRAV17*01'
......@@ -564,6 +569,7 @@ class ListWindows(VidjilJson):
self.d['reads'].d['distribution'] = {}
self.id_lengths = defaultdict(int)
try:
data.d["categories"]
......@@ -960,78 +966,34 @@ w5.d ={"id" : "aaa", "reads" : [5], "top" : 3 }
w6 = Window(1)
w6.d ={"id" : "bbb", "reads" : [12], "top" : 2 }
w7 = Window(1)
w7.d = {
"_average_read_length": [
149.625
],
"_coverage": [
0.9557226300239563
],
"_coverage_info": [
"143 bp (95% of 149.6 bp)"
],
"germline": "TRA",
"id": "TTCTTACTTCTGTGCTACGGACGCCGGGGCTCAGGAACCTACAAATACAT",
"name": "TRAV17*01 0/CCGGGG/5 TRAJ40*01",
"reads": [
16
],
"seg": {
"3": {
"delLeft": 5,
"name": "TRAJ40*01",
"start": 112
},
"5": {
"delRight": 0,
"name": "TRAV17*01",
"stop": 105
},
"N": 6,
"affectSigns": {
"seq": "++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ +++++++++++++++++++ ",
"start": 1,
"stop": 143
},
"affectValues": {
"seq": "AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA___________________aaaaaaaaaaaaaaaaaaa_____________",
"start": 1,
"stop": 143
},
"cdr3": {
"aa": "ATDAG#SGTYKYI",
"start": 96,
"stop": 133
},
"evalue": {
"val": "9.170265e-66"
},
"evalue_left": {
"val": "0.000000e+00"
},
"evalue_right": {
"val": "9.170265e-66"
},
"junction": {
"aa": "CATDAG#SGTYKYIF",
"productive": False,
"start": 93,
"stop": 136
},
"quality": {
"seq": "!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!FGGDGGGGGGGGGGGGGGFECGGFDEFEFEEFDFFEGFGGGFFFFGDFEE!!!!!!!!!!!",
"start": 1,
"stop": 143
}
},
"seg_stat": {
"2": 7,
"3": 9
},
"sequence": "GTGGAAGATTAAGAGTCACGCTTGACACTTCCAAGAAAAGCAGTTCCTTGTTGATCACGGCTTCCCGGGCAGCAGACACTGCTTCTTACTTCTGTGCTACGGACGCCGGGGCTCAGGAACCTACAAATACATCTTTGGAACAG",
"top": 26
seg_w7 = {
"germline": "TRA",
"id": "TTCTTACTTCTGTGCTACGGACGCCGGGGCTCAGGAACCTACAAATACAT",
"name": "TRAV17*01 0/CCGGGG/5 TRAJ40*01",
"reads": [
16
],
"seg": {
"3": {
"delLeft": 5,
"name": "TRAJ40*01",
"start": 112
},
"5": {
"delRight": 0,
"name": "TRAV17*01",
"stop": 105
},
"N": 6,
"cdr3": {
"aa": "ATDAG#SGTYKYI",
"start": 96,
"stop": 133
}
},
"sequence": "GTGGAAGATTAAGAGTCACGCTTGACACTTCCAAGAAAAGCAGTTCCTTGTTGATCACGGCTTCCCGGGCAGCAGACACTGCTTCTTACTTCTGTGCTACGGACGCCGGGGCTCAGGAACCTACAAATACATCTTTGGAACAG",
"top": 26
}
lw1 = ListWindows()
lw1.d["timestamp"] = 'ts'
......@@ -1204,6 +1166,9 @@ def main():
if args.ijson:
json_reads = vparser.extract(path_name)
jlist.loads(json_reads, args.pipeline)
if args.distributions or args.only_disributions:
jlist.init_distrib(LISTE_D)
jlist.compute_distribution(LISTE_D)
else:
jlist.load(path_name, args.pipeline)
if args.distributions or args.only_disributions:
......
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment