Commit ba51fb41 authored by Mikaël Salson's avatar Mikaël Salson

0215-ren-unseg.should-locus.fa: Unsegmented as a normal locus

At the time this test was made, we didn't launch Vidjil for looking unexpected recombinations.
This is the case for quite some time now and this sequence should have been found as unexpected
but a bug (see #3296) prevented it to be found.

This is now corrected.
parent d42e47b8
# PCR dimer (V4-K5), should not be segmented
#
>dimer [UNSEG] BUG-LOCUS
>dimer [unexpected]
GAGCTCTGTGACCGCCGCGGACACGACTGGAGATTAAACGTAAGTGTAGAACCATGTCGTCAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAAAAA
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment