Commit b35673bc authored by Mathieu Giraud's avatar Mathieu Giraud

tests: testing analysis-window.py

parent d590140c
{
"vidjil_json_version": "2014.10",
"reads": {
"germline": { "IGH": [ 13139 ] },
"segmented": [ 13139 ],
"total": [ 13153 ]
},
"samples": {
"commandline": [ "/some/cmd" ],
"log": [ "/some/log" ],
"number": 1,
"original_names": [ "/some.fasta" ],
"producer": [ "vidjil dev 83a82c1 (2015-02-24)" ],
"run_timestamp": [ "2015-02-24 23:52:34" ]
},
"clones": [
{
"germline": "IGH",
"id": "CCACCTATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTGGGGCC",
"sequence": "GCTGTACCTGCAAATGAACAGCCTGCGAGCCGAGGACACGGCCACCTATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTGGGGCCAGGGGATCCTGGTCACCGTCTCCTCAG",
"top": 1,
"name": "IGHV3-23*05 -6/18/-9 IGHD6-13*01 -0/0/-2 IGHJ4*02",
"reads": [ 8 ],
"seg": {
"3": "IGHJ4*02",
"3start": 82,
"4": "IGHD6-13*01",
"4end": 81,
"4start": 73,
"5": "IGHV3-23*05",
"5end": 54,
"5start": 0
}
},
{
"germline": "IGH",
"id": "CCACCTATTACTGTACCGGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTGGGGCC",
"sequence": "GCTGTACCTGCAAATGAACAGCCTGCGAGCCGAGGACACGGCCACCTATTACTGTACCGGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTGGGGCCAGGGGATCCTGGTCACCGTCTCCTCAG",
"top": 2,
"name": "Same than top-1, one mutation C>G at 18th position of the window",
"reads": [ 6 ]
},
{
"germline": "IGH",
"id": "TGTGCGAGAGGTTACTATGATAGTAGTGGTTATTACGGGGTAGGGCAGTACTACTACTAC",
"sequence": "GGACACGGCCGTGTATTACTGTGCGAGAGGTTACTATGATAGTAGTGGTTATTACGGGGTAGGGCAGTACTACTACTACTACATGGACGTCTGGGGCAAAGGGACCAC",
"top": 2,
"name": "IGHV1-8*01 -0/0/-3 IGHD3-22*01 -3/12/-5 IGHJ6*03",
"reads": [ 5 ],
"seg": {
"3": "IGHJ6*03",
"3start": 67,
"4": "IGHD3-22*01",
"4end": 54,
"4start": 30,
"5": "IGHV1-8*01",
"5end": 29,
"5start": 0
}
}
]
}
!LAUNCH: (cd .. ; python analysis-windows.py -w 40 ../data/analysis-with-windows.analysis.new ; python analysis-windows.py -w 60 ../data/analysis-with-windows.analysis.new ; ./diff_json.sh ../data/analysis-with-windows.analysis{,.new.new} -s ; cat ../data/analysis-with-windows.analysis.new)
$ First and last files are identical
1:are identical
$ Middle file has the good 40-bp windows
1: "id": "CTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGAC"
1: "id": "CTGTACCGGGGAGGAACAATATAGCAGCTGGTACTTTGAC"
1: "id": "GTTACTATGATAGTAGTGGTTATTACGGGGTAGGGCAGTA"
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment