Commit b33f6e9d authored by Mikaël Salson's avatar Mikaël Salson Committed by Mathieu Giraud

10-germlines-upstream.should-get: Full header not yet correct

We are aware that the header is not correct. However this is not new.

See !182
parent 28826097
......@@ -2,7 +2,7 @@
!LAUNCH: (cd $VIDJIL_DIR/germline ; cat homo-sapiens/TRDD2+up.fa | tr '|' '#' )
$ Correct full header, with TRDD2*01 identifier between pipes
1: .*#TRDD2.01#.*Human T-cell receptor germline delta-chain D-region DNA
f1: .*#TRDD2.01#.*Human T-cell receptor germline delta-chain D-region DNA
$ Correct sequence, with upstream
1: AAGAGGGTTTTTATACTGATGTGTTTCATTGTGCCTTCCTAC
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment