Commit b18c2caf authored by Mikaël Salson's avatar Mikaël Salson Committed by Mathieu Giraud

germline/tests: FASTA sequences on several lines

Not sure that the l flag from should.py could nicely apply here.
parent 40bb88cc
Pipeline #32564 passed with stages
in 7 minutes and 35 seconds
!NO_LAUNCHER:
!LAUNCH: (cd $VIDJIL_DIR/germline ; grep -A1 -F 'IGHD2-2*02' homo-sapiens/IGHD+up.fa)
!LAUNCH: (cd $VIDJIL_DIR/germline ; grep -A2 -F 'IGHD2-2*02' homo-sapiens/IGHD+up.fa | tr -d '\n')
$ Correct sequence, with upstream
1:AGGATTTTGTGGGGGCTCGTGTCACTGTGA
!NO_LAUNCHER:
!LAUNCH: (cd $VIDJIL_DIR/germline ; cat homo-sapiens/TRDD2+up.fa | tr '|' '#' )
!LAUNCH: (cd $VIDJIL_DIR/germline ; cat homo-sapiens/TRDD2+up.fa | tr '|' '#' | tr -d '\n')
$ Correct full header, with TRDD2*01 identifier between pipes
f1: .*#TRDD2.01#.*Human T-cell receptor germline delta-chain D-region DNA
......
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment