Commit ad4d0fd7 authored by Mathieu Giraud's avatar Mathieu Giraud

tests: gosh-igh.should-vdj.fa: a failed IGH sequence (DJ instead of VDJ) due to -t 0

This sequence, previously expertised in 84f2acae, fails since cd292aa0.
The tests are now passing.
parent 97753200
......@@ -10,7 +10,7 @@ OTHER_SRC=$(wildcard unit-tests/*.cpp)
LIB=../core/vidjil.a ../lib/lib.a
SHOULD=$(wildcard should-get-tests/*.should-get)
SHOULD_LOG=$(SHOULD:.should-get=.tap)
SHOULD_VDJ_EXPECTED_FAILS=--expected-fails 84
SHOULD_VDJ_EXPECTED_FAILS=--expected-fails 85
SHOULD_LOCUS_EXPECTED_FAILS=--expected-fails 2
SHOULD_VDJ=$(wildcard should-vdj-tests/*.should-vdj.fa)
SHOULD_LOCUS=$(wildcard should-vdj-tests/*.should-locus.fa)
......
......@@ -110,7 +110,7 @@ ACCCCMTGTCCAGTCCTGGGGGCCCCTGGCACAGCTGTCTGGACCCTCTCTATTCCCTGGGAAGCTCCYCCTGACAGCCC
# IGHD3-10*01 GTATTACTATGGTTCGGGGAGTTATTATAAC
# ||||||||||||||||||
# IGHJ4*02 ACTACTTTGACTACTGGGGCC
>IGHV1-58*02 2/13/0 IGHD3-10*01 (2/0/3, 1/0/4, 0/0/5) IGHJ4*02 [IGH]
>IGHV1-58*02 2/13/0 IGHD3-10*01 (2/0/3, 1/0/4, 0/0/5) IGHJ4*02 [IGH] BUG
CGGCAGTCTCCTGCAGGCTTCTGGATTCACCTTTACTAGCTCTGCTATGCAGTGGGTGCGACAGGCTCGTGGACAACGCCTTGAGTGGATAGGATGGATCGTCGTTGGCAGTGGTAACACAAACTACGCACAGAAGTTCCAGGAAAGAGTCACCATTACCAGGGACATGTCCACAAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCCGAGGACACGGCCGTGTATTACTGTGCGGCATCCTCCTTGGTAGGTATTACTATGGTTCGGGGAGTTATTATAACTTTGACTACTGGGGCCAGGGAACGCTGGTCACCGTCTCCTCAGGTAAA
#1400 vh2
......
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment