Commit aa93dc34 authored by Mikaël Salson's avatar Mikaël Salson

ext-nucleotides-N.should-vdj.fa: Other J gene

The start of TRGJ2*01 is identical (seen as a consequence of #3148)
parent 7e0ce9a7
>TRGV1*01, TRGV5*01 0//0 TRGJ1*01 [TRG]
>(TRGV1*01, TRGV5*01) 0//0 (TRGJ1*01, TRGJ2*01) [TRG]
NNNNNNNNNNNN
tactgtgccacctgggacagg
gaattattataagaaactctt
......
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment