Commit a5fe2ce9 authored by Mikaël Salson's avatar Mikaël Salson

should-vdj: encode locus correctly

parent d498b824
>IGHD6-13*01_8/TCCCCCCCCCCT/6_IGHJ1*01__IGH+
>IGHD6-13*01 8/TCCCCCCCCCCT/6 IGHJ1*01 [IGH+]
ATACGAGATATGGACAGATTACGGTAGCAGAGACTTGGTCTTGACCCCAGCAAGGGAAGGCCCCCAAACAGACCAGGAGGTTTCTGAAGGTGTCTGTGTCACAGTGGGGTATAGCAGCA
TCCCCCCCCCCT
TACTTCCAGCACTGGGGCCAGGGCACCCTGGTCACCGTCTCCTCAGGTAAG
......@@ -153,7 +153,7 @@ AGTGGCAGCCCAGGGCGACTCCTCATGAGTCTGCAGCTGC
#target 1270BM [IGK+]
>IGKV1-8*01 10/TCCTCACCCGCCTAAGG/8 KDE
>IGKV1-8*01 10/TCCTCACCCGCCTAAGG/8 KDE [IGK+]
GGGGTCCCATCAAGGTTCAGCGGCAGTGGATCTGGGACAGATTTCACTCTCACCATCAGCTGCCTGCAGTCT
GAAGATTTTGCAACTTATTACTGTCAACAGTATTATA
TCCTCACCCGCCTAAGG
......
......@@ -7,7 +7,7 @@
GGAGTCGGGGGGAGGCTTAGTTCAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAGCTACTGGATGCACTGGGTCCGCCAAGCTCCAGGGAAGGGGCTGGTGTGGGTCTCACGTATTAATAGTGATGGGAGTAGCACAAGCTACGCGGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACACGCTGTATCTGCAAATGAACAGTCTGAGAGCCGAGGACACGGCTGTGTATTACTGCCGCGGTCGATATTTTGACTGGTTATTACTTCGAACATGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGT
# 0215-ren-IGH+
>IGHD6-13*01_8/TCCCCCCCCCCT/6_IGHJ1*01__IGH+
>IGHD6-13*01 8/TCCCCCCCCCCT/6 IGHJ1*01 [IGH+]
ATACGAGATATGGACAGATTACGGTAGCAGAGACTTGGTCTTGACCCCAGCAAGGGAAGGCCCCCAAACAGACCAGGAGGTTTCTGAAGGTGTCTGTGTCACAGTGGGGTATAGCAGCA
TCCCCCCCCCCT
TACTTCCAGCACTGGGGCCAGGGCACCCTGGTCACCGTCTCCTCAGGTAAG
......
>TRGV1*01_0//0_TRGJ1*01__TRG
>TRGV1*01 0//0 TRGJ1*01 [TRG]
NNNNNNNNNNNN
tactgtgccacctgggacagg
gaattattataagaaactctt
......
>IGHV1-18*01 0//0 IGHD1-1*01 0//0 IGHJ1*01
>IGHV1-18*01 0//0 IGHD1-1*01 0//0 IGHJ1*01 [IGH]
actgtgcgagaga
ggtacaactggaacgac
gctgaatacttcc
......
>TRDV2*01_0//0_TRDJ1*01 TRD
>TRDV2*01_0//0_TRDJ1*01 [TRD]
gcaccatcagagagagatgaagggtcttactactgtgcctgtgacacc
acaccgataaactcatctttggaaaaggaacccgtgtgactgtggaaccaa
......@@ -14,6 +14,6 @@ actgggggatacg
atctctccagtaaggactgaagacagtgccacttactactgtgcctttag
actgggggatacg
>TRDV3*01_0//0_TRDJ4*01 TRD
>TRDV3*01_0//0_TRDJ4*01 [TRD]
atctctccagtaaggactgaagacagtgccacttactactgtgcctttag
ccagacccctgatctttggcaaaggaacctatctggaggtacaacaac
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment