Commit a564ff7a authored by Mikaël Salson's avatar Mikaël Salson

analysis-S22.should: We cannot test exactly the representative found

It will depend on the order in which reads are coming when computing
the representative but this order is random. What is important is that
we find a representative of the correct length with the correct sequence
whatever the read name and read positions are.
parent 4f577854
......@@ -26,7 +26,7 @@ $ First clone -- find the good number of reads
2:clone-001--.*--0000008
$ First clone -- find the good representative
1:clone-001--.*--lcl.FLN1FA001BQ9J5.1.-.88,232.-.4
1:GACAATTCCAAGAACACGCTGTACCTGCAAATGAACAGCCTGCGAGCCGAGGACACGGCCACCTATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTGGGGCCAGGGGATCCTGGTCACCGTCTCCTCAG
$ First clone -- find the good coverage
1:clone-001--.* 145 bp .62. of 232.0 bp.
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment