Commit a05b4383 authored by Mathieu Giraud's avatar Mathieu Giraud Committed by Mikaël Salson

tests: update

- as 'id' is defined and is not nucleic sequence, it is removed from highliting fields
- sortBySize changed due to change of read numbers
parent a98f4849
......@@ -175,7 +175,8 @@ QUnit.test("name, informations, getHtmlInfo", function(assert) {
console.log(m.samples.order);
html = m.clones[0].getHtmlInfo();
assert.includes(html, "<h2>Cluster info : hello</h2><div id='info_window'><table><tr><th></th><td>Diag</td><td>Fu-1</td><td>Fu-2</td><td>Fu-3</td></tr>",
assert.includes(html, "<h2>Cluster info : hello</h2>")
assert.includes(html, "<div id='info_window'><table><tr><th></th><td>Diag</td><td>Fu-1</td><td>Fu-2</td><td>Fu-3</td></tr>",
"getHtmlInfo: cluster info");
assert.includes(html, "<tr><td>clone name</td><td colspan='4'>hello</td></tr><tr><td>clone short name</td><td colspan='4'>hello</td></tr>",
......
......@@ -53,13 +53,13 @@ QUnit.test("sort", function(assert) {
var clone_list = document.getElementById('list').lastChild.childNodes
list.sortListBy(function(id){return m.clone(id).getSize()});
assert.notEqual(clone_list[0].innerHTML.indexOf("IGH smaller"), -1, "sortBySize: Ok");
assert.notEqual(clone_list[1].innerHTML.indexOf("TRG smaller"), -1, "sortBySize: Ok");
assert.notEqual(clone_list[2].innerHTML.indexOf("test1"), -1, "sortBySize: Ok");
assert.notEqual(clone_list[3].innerHTML.indexOf("test2"), -1, "sortBySize: Ok");
assert.notEqual(clone_list[4].innerHTML.indexOf("test4"), -1, "sortBySize: Ok");
assert.notEqual(clone_list[5].innerHTML.indexOf("unseg sequence"), -1, "sortBySize: Ok");
assert.notEqual(clone_list[6].innerHTML.indexOf("test3"), -1, "sortBySize: Ok");
assert.notEqual(clone_list[4].innerHTML.indexOf("IGH smaller"), -1, "sortBySize, IGH smaller");
assert.notEqual(clone_list[6].innerHTML.indexOf("TRG smaller"), -1, "sortBySize, TRG smaller");
assert.notEqual(clone_list[2].innerHTML.indexOf("test1"), -1, "sortBySize, test1");
assert.notEqual(clone_list[3].innerHTML.indexOf("test2"), -1, "sortBySize, test2");
assert.notEqual(clone_list[0].innerHTML.indexOf("test4"), -1, "sortBySize, test4");
assert.notEqual(clone_list[1].innerHTML.indexOf("unseg sequence"), -1, "sortBySize, unseg sequence");
assert.notEqual(clone_list[5].innerHTML.indexOf("test3"), -1, "sortBySize, test3");
list.sortListByV();
assert.notEqual(clone_list[0].innerHTML.indexOf("test3"), -1, "sortByV: Ok");
......
......@@ -39,7 +39,7 @@ QUnit.test("segmenter", function(assert) {
m.unselectAll();
//
assert.deepEqual(segment.findPotentialField(), ["","cdr3","fr1", "5", "id", "f1", "V-REGION","J-REGION","D-REGION","CDR3-IMGT"], "potentialField : Ok")
assert.deepEqual(segment.findPotentialField(), ["","cdr3","fr1", "5", "f1", "V-REGION","J-REGION","D-REGION","CDR3-IMGT"], "potentialField : Ok")
m.select(0)
// assert.deepEqual(segment.toFasta(), "> test1 // 5.000%\naaaaaaaaaaaaaaaaaaaAG\n","toFasta :Ok")
......@@ -140,7 +140,7 @@ QUnit.test("segt", function (assert) {
assert.ok(segment.isDNA('CACCCAGGAGGTGGAGCTGGATATTGAGACT'), "test dna")
assert.ok(segment.isAA('CACCCAGGAGGTGGAGCTGGATATTGAGACT'), "test AA")
assert.ok(segment.isPos(h), "test if an object contain pos")
assert.deepEqual(segment.findPotentialField(),["", "cdr3", "fr1", "5", "test_feature", "id", "f1", "V-REGION", "J-REGION", "D-REGION", "CDR3-IMGT"], "find field to highlight")
assert.deepEqual(segment.findPotentialField(),["", "cdr3", "fr1", "5", "test_feature", "f1", "V-REGION", "J-REGION", "D-REGION", "CDR3-IMGT"], "find field to highlight")
})
......
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment