Commit 9f548701 authored by Mathieu Giraud's avatar Mathieu Giraud

small_example.html: example data

parent 756ba614
......@@ -31,29 +31,42 @@
var vidjil_file = {
"vidjil_json_version": ["2014.09"],
"reads": {
"segmented": [200,100],
"total": [200,100],
"germline": {"TRG": [100,50], "IGH": [100,50]}
"segmented": [105, 32],
"total": [110, 40],
"germline": {"TRG": [100, 30], "IGH": [10, 7]}
},
"samples": {
"timestamp": ["2014-10-20 13:59:02", "2014-10-25 14:00:32"],
"number": 2,
"original_names": ["Diag.fa", "Fu-1.fa"]},
"clones": [
{ "sequence" : "ATGCACACACACACAGAGAGAGAGAGAGCACACACACACTATGGTAG",
"name" : "test1",
"id" : "id1",
"reads" : [10,10],
{ "id" : "clone-001",
"sequence" : "AGCTGGACGACTCGGCCCTGTATCTCTGTGCCAGCACCCGAGGGGACAGTAGAAACTAATGAAAAACTGTTTTTTGGCAGT",
"name" : "CASTRGDSRN**KTVF TRBV5-4 TRBJ1-4",
"reads" : [10, 5],
"top" : 1,
"germline" : "TRG",
"seg" : { "5" : "TRGV4*01", "3" : "TRGJ2*03", "3start" : 6, "5end" : 5 }},
{ "sequence" : "GATACAGATCAGATCAGTACAGATACAGATACAGATACA",
"name" : "test2",
"id" : "id2",
"reads" : [20,20],
"germline" : "TRB",
"seg" : { "5" : "TRBV5-4", "3" : "TRBJ1-4" }
},
{ "id" : "clone-002",
"sequence" : "GATACAGATCAGATCAGTACAGATACAGATACAGATACA",
"name" : "Test 2",
"reads" : [20, 20],
"top" : 2,
"germline" : "IGH",
"seg" : { "5" : "IGHV5*01","3" : "IGHJ2*04", "3start" : 15,"5end" : 5 }}]
"germline" : "TRG"
},
{ "id": "clone-003",
"sequence": "CTCATACACCCAGGAGGTGGAGCTGGATATTGATACTACGAAATCTAATTGAAAATGATTCTGGGGTCTATTACTGTGCCACCTGGGCCTTATTATAAGAAACTCTTTGGCAGTGGAAC",
"reads" : [ 75, 5],
"germline": "TRG",
"top": 3,
"seg":
{
"5": "TRGV5*01", "5start": 0, "5end": 86,
"3": "TRGJ1*02", "3start": 89, "3end": 118,
"cdr3": { "start": 77, "stop": 104, "seq": "gccacctgggccttattataagaaactc" }
}
}]
}
......
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment