Commit 88c6e924 authored by Mikaël Salson's avatar Mikaël Salson

algo/tests: Check that fine segmentation is independent on the number of reads.

This is not the case so far and should be corrected before next release.
parent fd902d8e
# We launch three times a sequence of interest (buggy-D.fa) with a various
# number of distinct reads (mutations randomly inserted in the middle).
# The segmentation of one sequence should not depend on the number of the
# other reads. This is what is tested, we first put 10 sequences, then 5 and
# finally just the sequence of interest alone.
!LAUNCH: (file1=$(mktemp); \
(for i in {1..10}; do \
echo '>seq'\\$i; echo ggctggagtgggtttcatacattagtagtaatagtggtgccatatactacgcagactctgtgaagggccgattcaccatctccagaaacaatgccaaggactcactgtatctgcaaatgaacagcctgagagccgaggacacggctgtgtattactgtgcgagagcgatcccccggtattactatgatact\\$(cat /dev/urandom | tr -dc 'acgt' | head -c 4)ggcccaaacgactactggggccagggaaccctggtcaccgtctcctcag; \
done;\
cat $VIDJIL_DIR/data/buggy-D.fa) > \\$file1; \
$VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -d -r 1 -w 60 -z 100 -G $VIDJIL_DIR/germline/IGH \\$file1; \
file2=$(mktemp); \
(for i in {1..5}; do \
echo '>seq'\\$i; echo ggctggagtgggtttcatacattagtagtaatagtggtgccatatactacgcagactctgtgaagggccgattcaccatctccagaaacaatgccaaggactcactgtatctgcaaatgaacagcctgagagccgaggacacggctgtgtattactgtgcgagagcgatcccccggtattactatgatact\\$(cat /dev/urandom | tr -dc 'acgt' | head -c 4)ggcccaaacgactactggggccagggaaccctggtcaccgtctcctcag; \
done;\
cat $VIDJIL_DIR/data/buggy-D.fa) > \\$file2; \
$VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -d -r 1 -w 60 -z 100 -G $VIDJIL_DIR/germline/IGH \\$file2;\
$VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -d -r 1 -w 60 -z 100 -G $VIDJIL_DIR/germline/IGH $VIDJIL_DIR/data/buggy-D.fa) | \
sort | uniq -c
$ Three times the same window
1: 3 TGTGCGGGATCTTCGTCCTCTTATCATAATAATGGTTTTTTGGCGGGGGAGTCATGGGGC
$ Three times the same segmentation
1: 3 IGHV4-34.*IGHD.*IGHJ4
>sequence
CCAGGGAAGGGGCTGGAGTGGATTGGGGAAATCAGTCATAGTGGAGGTACCGACTACAATCCGTCCCTCAAGAGTCGAGTCACCATAGCAGTAGACACGTCCAAGAGCCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCCGCGGACACGGCTACATATTACTGTGCGGGATCTTCGTCCTCTTATCATAATAATGGTTTTTTGGCGGGGGAGTCATGGGGCCAGGGAACCACGGTCAC
\ No newline at end of file
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment