Commit 88b507d1 authored by Mikaël Salson's avatar Mikaël Salson

browser/test/.../segmenter_test.js: Case insensitive sequence comparisons

Case changes may not be very meaningful.
Hum… actually why do we have lower and upper cases sequences?
parent 2f8c4a4e
......@@ -151,18 +151,18 @@ QUnit.test("segt", function (assert) {
var segment = new Segment("segment",m);
segment.init();
segment.addGermlineToSegmenter("IGHD1-1*01","IGH");
assert.equal(segment.sequence["IGHD1-1*01"].seq.join(""), "GGGCGCCGGGGCAGATTCTGAACAGCCCCGAGTCACGGTGGGTACAACTGGAACGAC")
assert.equal(segment.sequence["IGHD1-1*01"].seq.join("").toUpperCase(), "GGGCGCCGGGGCAGATTCTGAACAGCCCCGAGTCACGGTGGGTACAACTGGAACGAC")
assert.equal(segment.sequence["IGHD1-1*01"].is_clone, false);
m.select(2)
segment.addToSegmenter(2);
segment.add_all_germline_to_segmenter();
// segment.updateElem()
assert.equal(segment.sequence[2].seq.join(" "),"c c c c c c c c c c c c c c c c c c c c", "clone 3 sequence")
assert.equal(segment.sequence["IGHV1-2*01"].seq.join(""),"caggtgcagctggtgcagtctggggctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggatacaccttcaccggctactatatgcactgggtgcgacaggcccctggacaagggcttgagtggatgggacggatcaaccctaacagtggtggcacaaactatgcacagaagtttcagggcagggtcaccagtaccagggacacgtccatcagcacagcctacatggagctgagcaggctgagatctgacgacacggtcgtgtattactgtgcgagaga","5 germline")
assert.equal(segment.sequence["IGHD2-2*02"].seq.join(""),"GCGGGGACAGGAGGATTTTGTGGGGGCTCGTGTCACTGTGAGGATATTGTAGTAGTACCAGCTGCTATACC","4 germline")
assert.equal(segment.sequence["IGHJ6*01"].seq.join(""),"attactactactactacggtatggacgtctgggggcaagggaccacggtcaccgtctcctcag","3 germline")
assert.equal(segment.sequence["IGHV1-2*01"].seq.join("").toLowerCase(),"caggtgcagctggtgcagtctggggctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggatacaccttcaccggctactatatgcactgggtgcgacaggcccctggacaagggcttgagtggatgggacggatcaaccctaacagtggtggcacaaactatgcacagaagtttcagggcagggtcaccagtaccagggacacgtccatcagcacagcctacatggagctgagcaggctgagatctgacgacacggtcgtgtattactgtgcgagaga","5 germline")
assert.equal(segment.sequence["IGHD2-2*02"].seq.join("").toUpperCase(),"GCGGGGACAGGAGGATTTTGTGGGGGCTCGTGTCACTGTGAGGATATTGTAGTAGTACCAGCTGCTATACC","4 germline")
assert.equal(segment.sequence["IGHJ6*01"].seq.join("").toLowerCase(),"attactactactactacggtatggacgtctgggggcaagggaccacggtcaccgtctcctcag","3 germline")
segment.addSequenceTosegmenter("test","igh", "accccccgtgtagtagtcc")
assert.equal(segment.sequence["test"].seq.join(""),"accccccgtgtagtagtcc"," test sequence ")
assert.equal(segment.sequence["test"].seq.join("").toLowerCase(),"accccccgtgtagtagtcc"," test sequence ")
assert.equal(segment.sequence["test"].is_clone, false);
})
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment