Commit 8248c915 authored by Mathieu Giraud's avatar Mathieu Giraud

README: warning on segmentation

parent 34c4f1ec
......@@ -127,15 +127,20 @@ CTATGATAGTAGTGGTTATTACGGGGTAGGGCAGTACTACTACTACTACATGGACGTCTG
# with automatic clusterisation, distance five (-n 5)
./vidjil -c segment -G germline/IGH -d data/segment_S22.fa
# Segment the reads onto VDJ germline using a full comparison
# (dynamic programming) with all sequences.
# The output is displayed in .vdj format (see below)
# Segment the reads onto VDJ germline (see warning below)
### .vdj format
### Segmentation and .vdj format
Vidjil outputs include segmentation of V(D)J recombinations, obtained
by full comparison (dynamic programming) with all germline sequences
Such segmentations are not at the core of the Vidjil clone gathering
method (which relies only on the 'window', see above). They are
provided only for convenience and should be checked with other
softwares such as iHHMune-align, IgBlast or IMGT/V-QUEST.
Segmentations of V(D)J recombinations are displayed using a dedicated
format. This format is compatible with FASTA format. A line starting
.vdj format. This format is compatible with FASTA format. A line starting
with a > is of the following form:
>name + VDJ startV endV startD endD startJ endJ Vgene delV/N1/delD5' Dgene delD3'/N2/delJ Jgene
......
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment